FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635118_at:

>probe:Drosophila_2:1635118_at:36:83; Interrogation_Position=106; Antisense; AGGGATCACGGTTCAGCGATCCTTC
>probe:Drosophila_2:1635118_at:433:45; Interrogation_Position=149; Antisense; ATCCCATTCCGGAGCTGTGCGAGGA
>probe:Drosophila_2:1635118_at:239:155; Interrogation_Position=20; Antisense; ACAGCACCGACACGACAAGCATATA
>probe:Drosophila_2:1635118_at:277:77; Interrogation_Position=236; Antisense; AGGAGATCCAGAGGCACCGCAACAT
>probe:Drosophila_2:1635118_at:76:591; Interrogation_Position=260; Antisense; TGGTCAGCAAGTTCGGCAGGATCCC
>probe:Drosophila_2:1635118_at:32:77; Interrogation_Position=277; Antisense; AGGATCCCGGCGGACTTCAGCTGGT
>probe:Drosophila_2:1635118_at:161:63; Interrogation_Position=326; Antisense; ATGTGCGCCAACAGCGATTCCGGAG
>probe:Drosophila_2:1635118_at:382:561; Interrogation_Position=371; Antisense; GGAAACAGATAACGGCCTTCGAGAT
>probe:Drosophila_2:1635118_at:224:513; Interrogation_Position=410; Antisense; GTGAGGAGCAGAACCGCAAGCTATT
>probe:Drosophila_2:1635118_at:146:423; Interrogation_Position=436; Antisense; GAGAGCCAGCCCAAAAACCAGTAAA
>probe:Drosophila_2:1635118_at:588:229; Interrogation_Position=473; Antisense; AATGTCCAACATGCCAATCGAAGGG
>probe:Drosophila_2:1635118_at:308:529; Interrogation_Position=495; Antisense; GGGTAAACTCTGTCAAAATTGCTAA
>probe:Drosophila_2:1635118_at:320:97; Interrogation_Position=68; Antisense; AGATCAAGATCTGGAGCCGCTCGCC
>probe:Drosophila_2:1635118_at:15:143; Interrogation_Position=93; Antisense; ACTGATTCCGGCTAGGGATCACGGT

Paste this into a BLAST search page for me
AGGGATCACGGTTCAGCGATCCTTCATCCCATTCCGGAGCTGTGCGAGGAACAGCACCGACACGACAAGCATATAAGGAGATCCAGAGGCACCGCAACATTGGTCAGCAAGTTCGGCAGGATCCCAGGATCCCGGCGGACTTCAGCTGGTATGTGCGCCAACAGCGATTCCGGAGGGAAACAGATAACGGCCTTCGAGATGTGAGGAGCAGAACCGCAAGCTATTGAGAGCCAGCCCAAAAACCAGTAAAAATGTCCAACATGCCAATCGAAGGGGGGTAAACTCTGTCAAAATTGCTAAAGATCAAGATCTGGAGCCGCTCGCCACTGATTCCGGCTAGGGATCACGGT

Full Affymetrix probeset data:

Annotations for 1635118_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720