Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635120_at:

>probe:Drosophila_2:1635120_at:198:147; Interrogation_Position=2083; Antisense; ACTACGCTTGAAGACGGCGGCAGCA
>probe:Drosophila_2:1635120_at:59:331; Interrogation_Position=2099; Antisense; GCGGCAGCACACAGACGATGCAGCA
>probe:Drosophila_2:1635120_at:688:113; Interrogation_Position=2120; Antisense; AGCAGCGCGGCTTTCAGCTGGTCAA
>probe:Drosophila_2:1635120_at:513:99; Interrogation_Position=2151; Antisense; AGAGAAATGGTTCCCCGGCATTGAG
>probe:Drosophila_2:1635120_at:598:437; Interrogation_Position=2173; Antisense; GAGGAATTGCGCTCCAACTACAGCT
>probe:Drosophila_2:1635120_at:186:193; Interrogation_Position=2188; Antisense; AACTACAGCTCTTGGGACTGGGTCA
>probe:Drosophila_2:1635120_at:710:527; Interrogation_Position=2201; Antisense; GGGACTGGGTCATCGGCAAGACTCC
>probe:Drosophila_2:1635120_at:396:105; Interrogation_Position=2219; Antisense; AGACTCCCAAGTTCACCGTGCAGAA
>probe:Drosophila_2:1635120_at:729:121; Interrogation_Position=2344; Antisense; AGCGATCAGCTCGTCCCGGTGGTGA
>probe:Drosophila_2:1635120_at:366:267; Interrogation_Position=2377; Antisense; CAGGGCAAGCCCTACAACGAGGAGA
>probe:Drosophila_2:1635120_at:121:381; Interrogation_Position=2400; Antisense; GAACCTGAACGGAATACTTGGCGCC
>probe:Drosophila_2:1635120_at:152:117; Interrogation_Position=2429; Antisense; AGCTCGTCAGCGCATCGAATGTGAA
>probe:Drosophila_2:1635120_at:656:725; Interrogation_Position=2475; Antisense; TTGATTACTGTTGTGCTAGCTCGAA
>probe:Drosophila_2:1635120_at:253:419; Interrogation_Position=2533; Antisense; GAGCACTAACCACGCTAACGTAGTT

Paste this into a BLAST search page for me
ACTACGCTTGAAGACGGCGGCAGCAGCGGCAGCACACAGACGATGCAGCAAGCAGCGCGGCTTTCAGCTGGTCAAAGAGAAATGGTTCCCCGGCATTGAGGAGGAATTGCGCTCCAACTACAGCTAACTACAGCTCTTGGGACTGGGTCAGGGACTGGGTCATCGGCAAGACTCCAGACTCCCAAGTTCACCGTGCAGAAAGCGATCAGCTCGTCCCGGTGGTGACAGGGCAAGCCCTACAACGAGGAGAGAACCTGAACGGAATACTTGGCGCCAGCTCGTCAGCGCATCGAATGTGAATTGATTACTGTTGTGCTAGCTCGAAGAGCACTAACCACGCTAACGTAGTT

Full Affymetrix probeset data:

Annotations for 1635120_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime