Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635121_a_at:

>probe:Drosophila_2:1635121_a_at:222:505; Interrogation_Position=185; Antisense; GTGCCTACAGCAAGGTCGCAAGGAC
>probe:Drosophila_2:1635121_a_at:137:225; Interrogation_Position=204; Antisense; AAGGACCGGGCCAAGCTGCTGCTGC
>probe:Drosophila_2:1635121_a_at:397:487; Interrogation_Position=239; Antisense; GTACCAGGAGAGTCTGCTGACCAAT
>probe:Drosophila_2:1635121_a_at:209:207; Interrogation_Position=291; Antisense; AAGCTGGCTGCGGACATTGAGTTCG
>probe:Drosophila_2:1635121_a_at:660:445; Interrogation_Position=326; Antisense; GATGAAGGTGCTGGACGGCCTCAAA
>probe:Drosophila_2:1635121_a_at:600:173; Interrogation_Position=348; Antisense; AAAGCGGGCAATGCTGCTCTGAAGA
>probe:Drosophila_2:1635121_a_at:465:533; Interrogation_Position=374; Antisense; GGTGCACGAAATGCTTGACATCGAC
>probe:Drosophila_2:1635121_a_at:182:269; Interrogation_Position=413; Antisense; CATGGACGAGACACGCGAGGGCATC
>probe:Drosophila_2:1635121_a_at:68:27; Interrogation_Position=453; Antisense; ATAGACGCCATACTGACGGATGTGC
>probe:Drosophila_2:1635121_a_at:27:409; Interrogation_Position=467; Antisense; GACGGATGTGCTGACCACGCAGGAC
>probe:Drosophila_2:1635121_a_at:97:703; Interrogation_Position=502; Antisense; TTTTGGCCGAGCTGGATGCCCTGGA
>probe:Drosophila_2:1635121_a_at:244:119; Interrogation_Position=556; Antisense; AGCTGCCGGATGTGCCCACCGAAGA
>probe:Drosophila_2:1635121_a_at:216:11; Interrogation_Position=588; Antisense; ATTCCCGCTGAGATCGAGTCCGTCG
>probe:Drosophila_2:1635121_a_at:471:41; Interrogation_Position=600; Antisense; ATCGAGTCCGTCGAGGAGCCGGCAA

Paste this into a BLAST search page for me
GTGCCTACAGCAAGGTCGCAAGGACAAGGACCGGGCCAAGCTGCTGCTGCGTACCAGGAGAGTCTGCTGACCAATAAGCTGGCTGCGGACATTGAGTTCGGATGAAGGTGCTGGACGGCCTCAAAAAAGCGGGCAATGCTGCTCTGAAGAGGTGCACGAAATGCTTGACATCGACCATGGACGAGACACGCGAGGGCATCATAGACGCCATACTGACGGATGTGCGACGGATGTGCTGACCACGCAGGACTTTTGGCCGAGCTGGATGCCCTGGAAGCTGCCGGATGTGCCCACCGAAGAATTCCCGCTGAGATCGAGTCCGTCGATCGAGTCCGTCGAGGAGCCGGCAA

Full Affymetrix probeset data:

Annotations for 1635121_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime