Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635122_at:

>probe:Drosophila_2:1635122_at:529:681; Interrogation_Position=168; Antisense; TATGGTGCACTTTTTTGGATCGATT
>probe:Drosophila_2:1635122_at:159:365; Interrogation_Position=223; Antisense; GAATTTCTGGTGATCATCTATCTGG
>probe:Drosophila_2:1635122_at:364:527; Interrogation_Position=24; Antisense; GGGAACCTGGCTCAAATCCTGTTGC
>probe:Drosophila_2:1635122_at:602:283; Interrogation_Position=265; Antisense; CTGATCTTTTGTAGCCCCTTTATAA
>probe:Drosophila_2:1635122_at:609:651; Interrogation_Position=302; Antisense; TAAGTTGTAGCTTCTGCACTCTAGA
>probe:Drosophila_2:1635122_at:392:237; Interrogation_Position=326; Antisense; AATCGATTCCTGTATTCTTCACCCT
>probe:Drosophila_2:1635122_at:330:237; Interrogation_Position=359; Antisense; AATCTTCGAACTTCATTTGCATGGA
>probe:Drosophila_2:1635122_at:532:235; Interrogation_Position=38; Antisense; AATCCTGTTGCTGCTGTGTGAATCT
>probe:Drosophila_2:1635122_at:666:495; Interrogation_Position=401; Antisense; GTCAGCTCTTTCTTCCGATGGGTTT
>probe:Drosophila_2:1635122_at:650:441; Interrogation_Position=417; Antisense; GATGGGTTTTGTGGCCTCCAAGCAA
>probe:Drosophila_2:1635122_at:56:495; Interrogation_Position=444; Antisense; GTCACAGCTGCGACATGGCAATTGA
>probe:Drosophila_2:1635122_at:379:39; Interrogation_Position=59; Antisense; ATCTGCGGGCGGGATGCTTTTTCAT
>probe:Drosophila_2:1635122_at:120:53; Interrogation_Position=72; Antisense; ATGCTTTTTCATGGCGCTTTTCGAG
>probe:Drosophila_2:1635122_at:17:637; Interrogation_Position=92; Antisense; TCGAGATTTTCGCATCGATCCTGGG

Paste this into a BLAST search page for me
TATGGTGCACTTTTTTGGATCGATTGAATTTCTGGTGATCATCTATCTGGGGGAACCTGGCTCAAATCCTGTTGCCTGATCTTTTGTAGCCCCTTTATAATAAGTTGTAGCTTCTGCACTCTAGAAATCGATTCCTGTATTCTTCACCCTAATCTTCGAACTTCATTTGCATGGAAATCCTGTTGCTGCTGTGTGAATCTGTCAGCTCTTTCTTCCGATGGGTTTGATGGGTTTTGTGGCCTCCAAGCAAGTCACAGCTGCGACATGGCAATTGAATCTGCGGGCGGGATGCTTTTTCATATGCTTTTTCATGGCGCTTTTCGAGTCGAGATTTTCGCATCGATCCTGGG

Full Affymetrix probeset data:

Annotations for 1635122_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime