FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635123_at:

>probe:Drosophila_2:1635123_at:298:581; Interrogation_Position=3925; Antisense; TGGCCAACTTCCTGGTGGGCATATA
>probe:Drosophila_2:1635123_at:616:79; Interrogation_Position=3952; Antisense; AGGTCAGCGATTGTACGGACTCCAT
>probe:Drosophila_2:1635123_at:408:557; Interrogation_Position=3968; Antisense; GGACTCCATCACTATGCTGAACTAT
>probe:Drosophila_2:1635123_at:88:267; Interrogation_Position=4018; Antisense; CAGTGGTCGCTAACAGCCAGTACGT
>probe:Drosophila_2:1635123_at:267:457; Interrogation_Position=4070; Antisense; GATAGCTGCCGAGAACCAAGACGAT
>probe:Drosophila_2:1635123_at:27:237; Interrogation_Position=4114; Antisense; AATCGCCGCCGTCAGAGCAAATAGT
>probe:Drosophila_2:1635123_at:222:527; Interrogation_Position=4158; Antisense; GGGAGGGATACCACATTTGCGCCGC
>probe:Drosophila_2:1635123_at:33:19; Interrogation_Position=4172; Antisense; ATTTGCGCCGCCCTTGGAAAGTACG
>probe:Drosophila_2:1635123_at:14:527; Interrogation_Position=4201; Antisense; GGGACACAATACTCGCGCAAAATCT
>probe:Drosophila_2:1635123_at:665:179; Interrogation_Position=4227; Antisense; AAACAGGCCGCCACTGAGGTTGCTG
>probe:Drosophila_2:1635123_at:577:607; Interrogation_Position=4241; Antisense; TGAGGTTGCTGCTCAACCGTCAGAT
>probe:Drosophila_2:1635123_at:633:491; Interrogation_Position=4278; Antisense; GTAACCACGGATGTGTCCCTAGCAA
>probe:Drosophila_2:1635123_at:463:273; Interrogation_Position=4312; Antisense; CTTCCCCAGCCATACTTAATGTTTA
>probe:Drosophila_2:1635123_at:494:65; Interrogation_Position=4387; Antisense; CATGTTGTAAACTGCCTGGTAATCT

Paste this into a BLAST search page for me
TGGCCAACTTCCTGGTGGGCATATAAGGTCAGCGATTGTACGGACTCCATGGACTCCATCACTATGCTGAACTATCAGTGGTCGCTAACAGCCAGTACGTGATAGCTGCCGAGAACCAAGACGATAATCGCCGCCGTCAGAGCAAATAGTGGGAGGGATACCACATTTGCGCCGCATTTGCGCCGCCCTTGGAAAGTACGGGGACACAATACTCGCGCAAAATCTAAACAGGCCGCCACTGAGGTTGCTGTGAGGTTGCTGCTCAACCGTCAGATGTAACCACGGATGTGTCCCTAGCAACTTCCCCAGCCATACTTAATGTTTACATGTTGTAAACTGCCTGGTAATCT

Full Affymetrix probeset data:

Annotations for 1635123_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720