FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635124_at:

>probe:Drosophila_2:1635124_at:6:579; Interrogation_Position=2115; Antisense; GGCCAGCCGAAGCTTATATACCTTT
>probe:Drosophila_2:1635124_at:478:19; Interrogation_Position=2130; Antisense; ATATACCTTTGCTGTTAAAACCATG
>probe:Drosophila_2:1635124_at:341:393; Interrogation_Position=2165; Antisense; GAAAGTTCGCACAATTTCGATGAAG
>probe:Drosophila_2:1635124_at:514:23; Interrogation_Position=2247; Antisense; ATATGTACATTTTTGATTCTTGCTA
>probe:Drosophila_2:1635124_at:500:461; Interrogation_Position=2261; Antisense; GATTCTTGCTATGGTACTTGTACGT
>probe:Drosophila_2:1635124_at:191:605; Interrogation_Position=2287; Antisense; TGATATTGTTGATCGATCCTGCCCG
>probe:Drosophila_2:1635124_at:728:725; Interrogation_Position=2292; Antisense; TTGTTGATCGATCCTGCCCGAGTCA
>probe:Drosophila_2:1635124_at:600:303; Interrogation_Position=2309; Antisense; CCGAGTCACCTTTTATATCACCAGA
>probe:Drosophila_2:1635124_at:188:687; Interrogation_Position=2322; Antisense; TATATCACCAGACATGCCGATCATG
>probe:Drosophila_2:1635124_at:170:537; Interrogation_Position=2364; Antisense; GGTCGGAAATGCCTCACTGCTACCT
>probe:Drosophila_2:1635124_at:191:651; Interrogation_Position=2377; Antisense; TCACTGCTACCTTCAGACATATTAT
>probe:Drosophila_2:1635124_at:352:583; Interrogation_Position=2491; Antisense; TGTAAGACCCAACCACAAAATAGTT
>probe:Drosophila_2:1635124_at:135:477; Interrogation_Position=2513; Antisense; GTTATCCTGATAAACGGCTTAATGT
>probe:Drosophila_2:1635124_at:573:467; Interrogation_Position=2536; Antisense; GTTGAGCCGGACTAACAGAGTGTCT

Paste this into a BLAST search page for me
GGCCAGCCGAAGCTTATATACCTTTATATACCTTTGCTGTTAAAACCATGGAAAGTTCGCACAATTTCGATGAAGATATGTACATTTTTGATTCTTGCTAGATTCTTGCTATGGTACTTGTACGTTGATATTGTTGATCGATCCTGCCCGTTGTTGATCGATCCTGCCCGAGTCACCGAGTCACCTTTTATATCACCAGATATATCACCAGACATGCCGATCATGGGTCGGAAATGCCTCACTGCTACCTTCACTGCTACCTTCAGACATATTATTGTAAGACCCAACCACAAAATAGTTGTTATCCTGATAAACGGCTTAATGTGTTGAGCCGGACTAACAGAGTGTCT

Full Affymetrix probeset data:

Annotations for 1635124_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720