Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635127_at:

>probe:Drosophila_2:1635127_at:477:451; Interrogation_Position=104; Antisense; GATCTGGACATGGTCATCGGGAGCA
>probe:Drosophila_2:1635127_at:248:287; Interrogation_Position=107; Antisense; CTGGACATGGTCATCGGGAGCAGCA
>probe:Drosophila_2:1635127_at:468:55; Interrogation_Position=13; Antisense; ATGTTGGGATTTAGCGGGAAACACG
>probe:Drosophila_2:1635127_at:430:123; Interrogation_Position=148; Antisense; AGCCTGGCCACCTCGACGATGGCGA
>probe:Drosophila_2:1635127_at:436:313; Interrogation_Position=154; Antisense; GCCACCTCGACGATGGCGAGTAGCA
>probe:Drosophila_2:1635127_at:76:139; Interrogation_Position=163; Antisense; ACGATGGCGAGTAGCAGGCATCCGC
>probe:Drosophila_2:1635127_at:157:431; Interrogation_Position=171; Antisense; GAGTAGCAGGCATCCGCGGGATCGC
>probe:Drosophila_2:1635127_at:481:303; Interrogation_Position=184; Antisense; CCGCGGGATCGCCACGGCAAGGATA
>probe:Drosophila_2:1635127_at:317:525; Interrogation_Position=28; Antisense; GGGAAACACGGTAAAAGCACACTGA
>probe:Drosophila_2:1635127_at:468:537; Interrogation_Position=37; Antisense; GGTAAAAGCACACTGAATGGACATC
>probe:Drosophila_2:1635127_at:19:259; Interrogation_Position=47; Antisense; CACTGAATGGACATCAGCATCATCA
>probe:Drosophila_2:1635127_at:718:261; Interrogation_Position=84; Antisense; CAGCAGCGGCAAGCATCAGGGATCT
>probe:Drosophila_2:1635127_at:377:289; Interrogation_Position=90; Antisense; CGGCAAGCATCAGGGATCTGGACAT
>probe:Drosophila_2:1635127_at:522:345; Interrogation_Position=96; Antisense; GCATCAGGGATCTGGACATGGTCAT

Paste this into a BLAST search page for me
GATCTGGACATGGTCATCGGGAGCACTGGACATGGTCATCGGGAGCAGCAATGTTGGGATTTAGCGGGAAACACGAGCCTGGCCACCTCGACGATGGCGAGCCACCTCGACGATGGCGAGTAGCAACGATGGCGAGTAGCAGGCATCCGCGAGTAGCAGGCATCCGCGGGATCGCCCGCGGGATCGCCACGGCAAGGATAGGGAAACACGGTAAAAGCACACTGAGGTAAAAGCACACTGAATGGACATCCACTGAATGGACATCAGCATCATCACAGCAGCGGCAAGCATCAGGGATCTCGGCAAGCATCAGGGATCTGGACATGCATCAGGGATCTGGACATGGTCAT

Full Affymetrix probeset data:

Annotations for 1635127_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime