FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635129_at:

>probe:Drosophila_2:1635129_at:691:551; Interrogation_Position=1016; Antisense; GGAGAATCCATTCGGTATCGCGCCA
>probe:Drosophila_2:1635129_at:13:93; Interrogation_Position=1096; Antisense; AGTTCGAGAACACGCATATCCGGGA
>probe:Drosophila_2:1635129_at:290:529; Interrogation_Position=1117; Antisense; GGGAGAATCCGTTTGCCATATCGCC
>probe:Drosophila_2:1635129_at:5:557; Interrogation_Position=1223; Antisense; GGACTGTGCGTCTGGATAATCATTA
>probe:Drosophila_2:1635129_at:396:273; Interrogation_Position=1243; Antisense; CATTACCGTCCTTATTGGTGTTCTA
>probe:Drosophila_2:1635129_at:485:215; Interrogation_Position=1267; Antisense; AAGTTTTTCATTTCGGCTACATTTG
>probe:Drosophila_2:1635129_at:575:289; Interrogation_Position=1282; Antisense; GCTACATTTGGTATCGACTTTTCTA
>probe:Drosophila_2:1635129_at:370:403; Interrogation_Position=831; Antisense; GACTACAAGGCGACCAAGCGGATCA
>probe:Drosophila_2:1635129_at:325:455; Interrogation_Position=851; Antisense; GATCAAGCAAATATCGCAGCCCGTC
>probe:Drosophila_2:1635129_at:451:501; Interrogation_Position=873; Antisense; GTCGTGCGCGATAATGTCCACATCA
>probe:Drosophila_2:1635129_at:688:109; Interrogation_Position=901; Antisense; AGAATCCGGAGAAGGTCTCGCCCAA
>probe:Drosophila_2:1635129_at:666:231; Interrogation_Position=924; Antisense; AATGCCCTTCGCTACAAGCCGAGTG
>probe:Drosophila_2:1635129_at:558:303; Interrogation_Position=942; Antisense; CCGAGTGCCCGCATCAAGGAGATGT
>probe:Drosophila_2:1635129_at:543:223; Interrogation_Position=957; Antisense; AAGGAGATGTCCGAGCCACTTACCA

Paste this into a BLAST search page for me
GGAGAATCCATTCGGTATCGCGCCAAGTTCGAGAACACGCATATCCGGGAGGGAGAATCCGTTTGCCATATCGCCGGACTGTGCGTCTGGATAATCATTACATTACCGTCCTTATTGGTGTTCTAAAGTTTTTCATTTCGGCTACATTTGGCTACATTTGGTATCGACTTTTCTAGACTACAAGGCGACCAAGCGGATCAGATCAAGCAAATATCGCAGCCCGTCGTCGTGCGCGATAATGTCCACATCAAGAATCCGGAGAAGGTCTCGCCCAAAATGCCCTTCGCTACAAGCCGAGTGCCGAGTGCCCGCATCAAGGAGATGTAAGGAGATGTCCGAGCCACTTACCA

Full Affymetrix probeset data:

Annotations for 1635129_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720