Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635130_a_at:

>probe:Drosophila_2:1635130_a_at:709:99; Interrogation_Position=132; Antisense; AGAGCTCCAACGGTGACGATGATCT
>probe:Drosophila_2:1635130_a_at:149:139; Interrogation_Position=186; Antisense; ACGTGCTTAGCAATGTCAACTGTCA
>probe:Drosophila_2:1635130_a_at:396:233; Interrogation_Position=327; Antisense; AATGCCTGGGTCAGTTGCTTAAGCT
>probe:Drosophila_2:1635130_a_at:50:351; Interrogation_Position=380; Antisense; GCAGACTTGTTCTACTCGCGAAAAA
>probe:Drosophila_2:1635130_a_at:581:183; Interrogation_Position=402; Antisense; AAAATTTCACTAGACCGGAGGCGCA
>probe:Drosophila_2:1635130_a_at:28:1; Interrogation_Position=479; Antisense; AGATAACTCCCCATCAAGGCTTTAC
>probe:Drosophila_2:1635130_a_at:414:437; Interrogation_Position=505; Antisense; GAGGAAGTTACGTATCTGGACTCAA
>probe:Drosophila_2:1635130_a_at:586:585; Interrogation_Position=521; Antisense; TGGACTCAATTTTTCCCAACGGAAG
>probe:Drosophila_2:1635130_a_at:334:371; Interrogation_Position=542; Antisense; GAAGATCCTATTGTCTGGGCTCCAT
>probe:Drosophila_2:1635130_a_at:594:379; Interrogation_Position=567; Antisense; GAACCTGGAGTGTTGGTACCTCTAC
>probe:Drosophila_2:1635130_a_at:354:487; Interrogation_Position=582; Antisense; GTACCTCTACACTTTTAGTCGTTCT
>probe:Drosophila_2:1635130_a_at:53:429; Interrogation_Position=607; Antisense; GATATCAAAATTACGCCCCAACTTA
>probe:Drosophila_2:1635130_a_at:693:671; Interrogation_Position=618; Antisense; TACGCCCCAACTTATATCGGATGAG
>probe:Drosophila_2:1635130_a_at:245:179; Interrogation_Position=643; Antisense; AAAAACGTTGACTCCGATCCAGATC

Paste this into a BLAST search page for me
AGAGCTCCAACGGTGACGATGATCTACGTGCTTAGCAATGTCAACTGTCAAATGCCTGGGTCAGTTGCTTAAGCTGCAGACTTGTTCTACTCGCGAAAAAAAAATTTCACTAGACCGGAGGCGCAAGATAACTCCCCATCAAGGCTTTACGAGGAAGTTACGTATCTGGACTCAATGGACTCAATTTTTCCCAACGGAAGGAAGATCCTATTGTCTGGGCTCCATGAACCTGGAGTGTTGGTACCTCTACGTACCTCTACACTTTTAGTCGTTCTGATATCAAAATTACGCCCCAACTTATACGCCCCAACTTATATCGGATGAGAAAAACGTTGACTCCGATCCAGATC

Full Affymetrix probeset data:

Annotations for 1635130_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime