Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635131_at:

>probe:Drosophila_2:1635131_at:313:651; Interrogation_Position=1365; Antisense; TCAACTATAACTTTGCCCAGGCGAA
>probe:Drosophila_2:1635131_at:394:575; Interrogation_Position=1384; Antisense; GGCGAAATGCGCCACAGGATATTAC
>probe:Drosophila_2:1635131_at:177:335; Interrogation_Position=1426; Antisense; GCTGATGCAGATCTCCGACATGGAT
>probe:Drosophila_2:1635131_at:17:29; Interrogation_Position=1464; Antisense; ATACCTACTGCATGATCCTGGCCAA
>probe:Drosophila_2:1635131_at:612:219; Interrogation_Position=1487; Antisense; AAGTGCCACATACATTGCGGTCACC
>probe:Drosophila_2:1635131_at:97:495; Interrogation_Position=1506; Antisense; GTCACCCTGAGCTAGCTTGGAATGT
>probe:Drosophila_2:1635131_at:510:585; Interrogation_Position=1523; Antisense; TGGAATGTATTCATCACCAGGGATA
>probe:Drosophila_2:1635131_at:589:329; Interrogation_Position=1553; Antisense; GCGGAGGCATTTATCCTGTTGCAAC
>probe:Drosophila_2:1635131_at:487:387; Interrogation_Position=1643; Antisense; GAAAAACTAGATCCCAGTCCGGAGA
>probe:Drosophila_2:1635131_at:104:93; Interrogation_Position=1699; Antisense; AGTTTTGTTCGCCTTGTGCACCAAG
>probe:Drosophila_2:1635131_at:92:79; Interrogation_Position=1732; Antisense; AGGTCGTCCTGGTGGAGGAATCTCA
>probe:Drosophila_2:1635131_at:117:239; Interrogation_Position=1750; Antisense; AATCTCAGAGGTCATCGGCATCCTA
>probe:Drosophila_2:1635131_at:522:403; Interrogation_Position=1778; Antisense; GACTCGTCGAACTCGCAGGCTGAGG
>probe:Drosophila_2:1635131_at:595:573; Interrogation_Position=1795; Antisense; GGCTGAGGCCATGATCAAAACGATT

Paste this into a BLAST search page for me
TCAACTATAACTTTGCCCAGGCGAAGGCGAAATGCGCCACAGGATATTACGCTGATGCAGATCTCCGACATGGATATACCTACTGCATGATCCTGGCCAAAAGTGCCACATACATTGCGGTCACCGTCACCCTGAGCTAGCTTGGAATGTTGGAATGTATTCATCACCAGGGATAGCGGAGGCATTTATCCTGTTGCAACGAAAAACTAGATCCCAGTCCGGAGAAGTTTTGTTCGCCTTGTGCACCAAGAGGTCGTCCTGGTGGAGGAATCTCAAATCTCAGAGGTCATCGGCATCCTAGACTCGTCGAACTCGCAGGCTGAGGGGCTGAGGCCATGATCAAAACGATT

Full Affymetrix probeset data:

Annotations for 1635131_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime