Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635132_at:

>probe:Drosophila_2:1635132_at:61:463; Interrogation_Position=1273; Antisense; GATTACCATCAGGAGCACCTCAAGG
>probe:Drosophila_2:1635132_at:115:619; Interrogation_Position=1301; Antisense; TGCAGTTTCGCACCCAAAAGATGTT
>probe:Drosophila_2:1635132_at:168:443; Interrogation_Position=1320; Antisense; GATGTTGGCCCAATCCAGCAAAGGG
>probe:Drosophila_2:1635132_at:560:717; Interrogation_Position=1366; Antisense; TTGACTTACAGGAGCCAAGCGGCGC
>probe:Drosophila_2:1635132_at:408:443; Interrogation_Position=1432; Antisense; GATGTCTTCAAATACAGCCTGATGG
>probe:Drosophila_2:1635132_at:574:151; Interrogation_Position=1470; Antisense; ACATCACTTGATAAGCGCCTTTGCC
>probe:Drosophila_2:1635132_at:453:257; Interrogation_Position=1494; Antisense; CACCGAGGGCATTACAATTGGCAGC
>probe:Drosophila_2:1635132_at:533:113; Interrogation_Position=1560; Antisense; AGCAGTCAGTTGCTTGTCACGCAAT
>probe:Drosophila_2:1635132_at:442:21; Interrogation_Position=1613; Antisense; ATATTGCTGGTTTAGAACTGGCCTA
>probe:Drosophila_2:1635132_at:402:195; Interrogation_Position=1628; Antisense; AACTGGCCTATTTTACTTATGCTAA
>probe:Drosophila_2:1635132_at:687:623; Interrogation_Position=1665; Antisense; TCGAAACCGTTTGGATTTCACCCAT
>probe:Drosophila_2:1635132_at:545:459; Interrogation_Position=1704; Antisense; GATATTCTTCCTAAATGTTGGCCAG
>probe:Drosophila_2:1635132_at:347:455; Interrogation_Position=1771; Antisense; GATCAAGTGCGTTTACAGCGAGCTA
>probe:Drosophila_2:1635132_at:704:223; Interrogation_Position=1819; Antisense; AAGGCTTTTGGGTGCTACCGCAATA

Paste this into a BLAST search page for me
GATTACCATCAGGAGCACCTCAAGGTGCAGTTTCGCACCCAAAAGATGTTGATGTTGGCCCAATCCAGCAAAGGGTTGACTTACAGGAGCCAAGCGGCGCGATGTCTTCAAATACAGCCTGATGGACATCACTTGATAAGCGCCTTTGCCCACCGAGGGCATTACAATTGGCAGCAGCAGTCAGTTGCTTGTCACGCAATATATTGCTGGTTTAGAACTGGCCTAAACTGGCCTATTTTACTTATGCTAATCGAAACCGTTTGGATTTCACCCATGATATTCTTCCTAAATGTTGGCCAGGATCAAGTGCGTTTACAGCGAGCTAAAGGCTTTTGGGTGCTACCGCAATA

Full Affymetrix probeset data:

Annotations for 1635132_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime