Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635136_at:

>probe:Drosophila_2:1635136_at:520:631; Interrogation_Position=1680; Antisense; TCCCTTTGTAAGAGTTTTGCCCTAT
>probe:Drosophila_2:1635136_at:672:687; Interrogation_Position=1702; Antisense; TATATCGTGGGAGCCATAGCCGCAT
>probe:Drosophila_2:1635136_at:529:521; Interrogation_Position=1788; Antisense; GTGGCATTTCAGTCTCAAGGTGTTC
>probe:Drosophila_2:1635136_at:265:595; Interrogation_Position=1814; Antisense; TGGGCTGCATCTACTCTACGGTGAA
>probe:Drosophila_2:1635136_at:244:357; Interrogation_Position=1836; Antisense; GAAGCGGGATCTGGGTTACCTTATC
>probe:Drosophila_2:1635136_at:246:475; Interrogation_Position=1850; Antisense; GTTACCTTATCACCATATCGCTATT
>probe:Drosophila_2:1635136_at:495:695; Interrogation_Position=1895; Antisense; TTTCCCTCACCATTTGCTGGATGAT
>probe:Drosophila_2:1635136_at:334:547; Interrogation_Position=1965; Antisense; GGAGGCCAAGTTCTTTCAGCATTTG
>probe:Drosophila_2:1635136_at:13:307; Interrogation_Position=1995; Antisense; CCTGTCCTACGCCATATATCTATTA
>probe:Drosophila_2:1635136_at:282:513; Interrogation_Position=2029; Antisense; GTGATTGCCCTCGTTTACAGTCTGA
>probe:Drosophila_2:1635136_at:231:89; Interrogation_Position=2056; Antisense; AGTACGAGCTCTGCAGTTGATCCCT
>probe:Drosophila_2:1635136_at:677:121; Interrogation_Position=2089; Antisense; AGCGTCATCTGCTGCGGGTTTACGA
>probe:Drosophila_2:1635136_at:144:669; Interrogation_Position=2109; Antisense; TACGATGATCGTTTATCTGGCCTCC
>probe:Drosophila_2:1635136_at:698:237; Interrogation_Position=2170; Antisense; AATCTGTCTAGTTTGCTGCTCAAGG

Paste this into a BLAST search page for me
TCCCTTTGTAAGAGTTTTGCCCTATTATATCGTGGGAGCCATAGCCGCATGTGGCATTTCAGTCTCAAGGTGTTCTGGGCTGCATCTACTCTACGGTGAAGAAGCGGGATCTGGGTTACCTTATCGTTACCTTATCACCATATCGCTATTTTTCCCTCACCATTTGCTGGATGATGGAGGCCAAGTTCTTTCAGCATTTGCCTGTCCTACGCCATATATCTATTAGTGATTGCCCTCGTTTACAGTCTGAAGTACGAGCTCTGCAGTTGATCCCTAGCGTCATCTGCTGCGGGTTTACGATACGATGATCGTTTATCTGGCCTCCAATCTGTCTAGTTTGCTGCTCAAGG

Full Affymetrix probeset data:

Annotations for 1635136_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime