Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635138_at:

>probe:Drosophila_2:1635138_at:85:643; Interrogation_Position=3689; Antisense; TCTGCTATGCCTATGTGGTGCGTAG
>probe:Drosophila_2:1635138_at:589:159; Interrogation_Position=3784; Antisense; ACAACTGTGCTCCTTTTGGTTTCGG
>probe:Drosophila_2:1635138_at:529:459; Interrogation_Position=3810; Antisense; GATTTTCACCCTGATGGGCGTAGCA
>probe:Drosophila_2:1635138_at:274:317; Interrogation_Position=3838; Antisense; GCCGGTGGCATCGTGTATCATCGAA
>probe:Drosophila_2:1635138_at:644:371; Interrogation_Position=3860; Antisense; GAAGGGCAATGGCTCGATCCAACGA
>probe:Drosophila_2:1635138_at:688:447; Interrogation_Position=3875; Antisense; GATCCAACGAACTATACTCCCGAGT
>probe:Drosophila_2:1635138_at:596:629; Interrogation_Position=3909; Antisense; TCCGGGTGACGAAAGTGACTCTGAC
>probe:Drosophila_2:1635138_at:230:437; Interrogation_Position=3934; Antisense; GAGGATGAACTGTTTACGGCCCACT
>probe:Drosophila_2:1635138_at:340:577; Interrogation_Position=3951; Antisense; GGCCCACTTCCCAGCGAGAAAGAGT
>probe:Drosophila_2:1635138_at:129:23; Interrogation_Position=3985; Antisense; ATATATCGCGATGAAGCGCCCAGCG
>probe:Drosophila_2:1635138_at:415:95; Interrogation_Position=4031; Antisense; AGATCAGCCACTTGGTACCCTAAAT
>probe:Drosophila_2:1635138_at:653:679; Interrogation_Position=4076; Antisense; TAGGTCATGCATTTAGCCATCCTCA
>probe:Drosophila_2:1635138_at:684:121; Interrogation_Position=4129; Antisense; AGCGACCGACAAACGCATTTTTGGT
>probe:Drosophila_2:1635138_at:111:289; Interrogation_Position=4174; Antisense; CGGCATTACAGCTCCTTTATTTCAA

Paste this into a BLAST search page for me
TCTGCTATGCCTATGTGGTGCGTAGACAACTGTGCTCCTTTTGGTTTCGGGATTTTCACCCTGATGGGCGTAGCAGCCGGTGGCATCGTGTATCATCGAAGAAGGGCAATGGCTCGATCCAACGAGATCCAACGAACTATACTCCCGAGTTCCGGGTGACGAAAGTGACTCTGACGAGGATGAACTGTTTACGGCCCACTGGCCCACTTCCCAGCGAGAAAGAGTATATATCGCGATGAAGCGCCCAGCGAGATCAGCCACTTGGTACCCTAAATTAGGTCATGCATTTAGCCATCCTCAAGCGACCGACAAACGCATTTTTGGTCGGCATTACAGCTCCTTTATTTCAA

Full Affymetrix probeset data:

Annotations for 1635138_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime