FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635139_at:

>probe:Drosophila_2:1635139_at:589:535; Interrogation_Position=1553; Antisense; GGTCCAACTCACACTACATCTGGAA
>probe:Drosophila_2:1635139_at:268:123; Interrogation_Position=1586; Antisense; AGCGAGCTGGCTCCATTTCCGGTGA
>probe:Drosophila_2:1635139_at:490:145; Interrogation_Position=1640; Antisense; ACTACAGGCGCCAGGTCACCGATGA
>probe:Drosophila_2:1635139_at:725:55; Interrogation_Position=1661; Antisense; ATGAGCGCGCCTATGATCTGAGCAA
>probe:Drosophila_2:1635139_at:460:403; Interrogation_Position=1784; Antisense; GACTCCTGTCCAAGTACGGTCTAGT
>probe:Drosophila_2:1635139_at:224:289; Interrogation_Position=1800; Antisense; CGGTCTAGTGCCCTATCTAACTAAG
>probe:Drosophila_2:1635139_at:1:211; Interrogation_Position=1822; Antisense; AAGAAGCGTATGACCGGACGACCCA
>probe:Drosophila_2:1635139_at:725:597; Interrogation_Position=1857; Antisense; TGTTCAGTTCGTCTACCAAATGGCC
>probe:Drosophila_2:1635139_at:529:255; Interrogation_Position=1873; Antisense; CAAATGGCCTGTCCGGAGATGAAGT
>probe:Drosophila_2:1635139_at:269:541; Interrogation_Position=1920; Antisense; GGTTCTGTTGCCGTGTGATCAGTGA
>probe:Drosophila_2:1635139_at:619:83; Interrogation_Position=1947; Antisense; AGTGCAGTGATCAGTGGCCGATTCA
>probe:Drosophila_2:1635139_at:714:577; Interrogation_Position=1962; Antisense; GGCCGATTCACATTCGACCAAGTGT
>probe:Drosophila_2:1635139_at:284:17; Interrogation_Position=2021; Antisense; ATTTTCGGCGTGATTTTGGCATAAA
>probe:Drosophila_2:1635139_at:644:529; Interrogation_Position=2077; Antisense; GGCGGAGGTTACTGTTAAAGCTTCA

Paste this into a BLAST search page for me
GGTCCAACTCACACTACATCTGGAAAGCGAGCTGGCTCCATTTCCGGTGAACTACAGGCGCCAGGTCACCGATGAATGAGCGCGCCTATGATCTGAGCAAGACTCCTGTCCAAGTACGGTCTAGTCGGTCTAGTGCCCTATCTAACTAAGAAGAAGCGTATGACCGGACGACCCATGTTCAGTTCGTCTACCAAATGGCCCAAATGGCCTGTCCGGAGATGAAGTGGTTCTGTTGCCGTGTGATCAGTGAAGTGCAGTGATCAGTGGCCGATTCAGGCCGATTCACATTCGACCAAGTGTATTTTCGGCGTGATTTTGGCATAAAGGCGGAGGTTACTGTTAAAGCTTCA

Full Affymetrix probeset data:

Annotations for 1635139_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720