FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635140_at:

>probe:Drosophila_2:1635140_at:588:307; Interrogation_Position=486; Antisense; CCAAGACTAATGTGACCCGTTCGTT
>probe:Drosophila_2:1635140_at:455:471; Interrogation_Position=504; Antisense; GTTCGTTTCTCACAGCTACTTTTCA
>probe:Drosophila_2:1635140_at:726:155; Interrogation_Position=556; Antisense; ACAGCTCGGCGGGACTTCTGGACTA
>probe:Drosophila_2:1635140_at:360:679; Interrogation_Position=585; Antisense; TTCCCCACCATTGTGTCGGAGTATT
>probe:Drosophila_2:1635140_at:680:547; Interrogation_Position=602; Antisense; GGAGTATTACAACCAGGCGCCGACC
>probe:Drosophila_2:1635140_at:242:387; Interrogation_Position=623; Antisense; GACCAAGGAGGGATACCGCTTCGCG
>probe:Drosophila_2:1635140_at:23:719; Interrogation_Position=642; Antisense; TTCGCGTCGGAGGAGCCAAATGGCA
>probe:Drosophila_2:1635140_at:226:63; Interrogation_Position=681; Antisense; ATGGGCGTGATCATGAACCCCGGCA
>probe:Drosophila_2:1635140_at:351:589; Interrogation_Position=724; Antisense; TGGTCATGGGTATGTACTCCTCGTA
>probe:Drosophila_2:1635140_at:589:103; Interrogation_Position=757; Antisense; AGACTGACACCGAGACTGTGACGAT
>probe:Drosophila_2:1635140_at:581:595; Interrogation_Position=773; Antisense; TGTGACGATGTACACCGCCGACAAG
>probe:Drosophila_2:1635140_at:425:395; Interrogation_Position=792; Antisense; GACAAGGATGGTTACAAGGCCCGTT
>probe:Drosophila_2:1635140_at:1:69; Interrogation_Position=808; Antisense; AGGCCCGTTACCAGATCAAGAACCG
>probe:Drosophila_2:1635140_at:669:217; Interrogation_Position=855; Antisense; AAGTCCGCTGCTGGATAAGGAGCTT

Paste this into a BLAST search page for me
CCAAGACTAATGTGACCCGTTCGTTGTTCGTTTCTCACAGCTACTTTTCAACAGCTCGGCGGGACTTCTGGACTATTCCCCACCATTGTGTCGGAGTATTGGAGTATTACAACCAGGCGCCGACCGACCAAGGAGGGATACCGCTTCGCGTTCGCGTCGGAGGAGCCAAATGGCAATGGGCGTGATCATGAACCCCGGCATGGTCATGGGTATGTACTCCTCGTAAGACTGACACCGAGACTGTGACGATTGTGACGATGTACACCGCCGACAAGGACAAGGATGGTTACAAGGCCCGTTAGGCCCGTTACCAGATCAAGAACCGAAGTCCGCTGCTGGATAAGGAGCTT

Full Affymetrix probeset data:

Annotations for 1635140_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720