FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635141_at:

>probe:Drosophila_2:1635141_at:583:295; Interrogation_Position=105; Antisense; CGAAATGGGTTTCACGCTCAGCGAA
>probe:Drosophila_2:1635141_at:94:339; Interrogation_Position=120; Antisense; GCTCAGCGAAAGATTGGCCCTCAGA
>probe:Drosophila_2:1635141_at:651:153; Interrogation_Position=144; Antisense; ACAGGCGTGGAACTTGGTCAGACCC
>probe:Drosophila_2:1635141_at:22:591; Interrogation_Position=158; Antisense; TGGTCAGACCCTTTGAGCGGCGCTA
>probe:Drosophila_2:1635141_at:70:291; Interrogation_Position=183; Antisense; CGGTCAGGACGTATTCTATAGCTTC
>probe:Drosophila_2:1635141_at:295:419; Interrogation_Position=253; Antisense; GAGCTCAACGTGAAAGCCCTGCACT
>probe:Drosophila_2:1635141_at:28:349; Interrogation_Position=279; Antisense; GCATGCCCTGCGATTTATTAACTTT
>probe:Drosophila_2:1635141_at:189:77; Interrogation_Position=326; Antisense; AGGATCCAGTAGTGTTCCAGCTGAT
>probe:Drosophila_2:1635141_at:108:627; Interrogation_Position=382; Antisense; TGCCATGTGGGCTCCGTTAATATTG
>probe:Drosophila_2:1635141_at:389:81; Interrogation_Position=443; Antisense; AGGTGTTCCATAAGGTCAGCTCTCC
>probe:Drosophila_2:1635141_at:602:725; Interrogation_Position=46; Antisense; TTGTCAAGTCTTACCTACCCAAAGC
>probe:Drosophila_2:1635141_at:288:479; Interrogation_Position=504; Antisense; GTTTCAGAACTACCAGGACCAGCAG
>probe:Drosophila_2:1635141_at:714:349; Interrogation_Position=525; Antisense; GCAGTCGAATACCTCCGGATACAAT
>probe:Drosophila_2:1635141_at:151:709; Interrogation_Position=563; Antisense; TTAACTTTGATTCACGACCGCCCAG

Paste this into a BLAST search page for me
CGAAATGGGTTTCACGCTCAGCGAAGCTCAGCGAAAGATTGGCCCTCAGAACAGGCGTGGAACTTGGTCAGACCCTGGTCAGACCCTTTGAGCGGCGCTACGGTCAGGACGTATTCTATAGCTTCGAGCTCAACGTGAAAGCCCTGCACTGCATGCCCTGCGATTTATTAACTTTAGGATCCAGTAGTGTTCCAGCTGATTGCCATGTGGGCTCCGTTAATATTGAGGTGTTCCATAAGGTCAGCTCTCCTTGTCAAGTCTTACCTACCCAAAGCGTTTCAGAACTACCAGGACCAGCAGGCAGTCGAATACCTCCGGATACAATTTAACTTTGATTCACGACCGCCCAG

Full Affymetrix probeset data:

Annotations for 1635141_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720