FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635143_at:

>probe:Drosophila_2:1635143_at:519:289; Interrogation_Position=1010; Antisense; CGGTCAGCTGGGAGTGCATTTATAC
>probe:Drosophila_2:1635143_at:703:7; Interrogation_Position=1043; Antisense; ATTCCTCAAATTCGTTCAGACCGTC
>probe:Drosophila_2:1635143_at:701:101; Interrogation_Position=1060; Antisense; AGACCGTCATACCAACCATCGAATA
>probe:Drosophila_2:1635143_at:20:653; Interrogation_Position=1102; Antisense; TCAACATGTCTTAAGACCCGCCATG
>probe:Drosophila_2:1635143_at:713:411; Interrogation_Position=1116; Antisense; GACCCGCCATGCTTTTCAATATTGA
>probe:Drosophila_2:1635143_at:67:139; Interrogation_Position=613; Antisense; ACGATTTCGAGGAGAGCGGCATGCT
>probe:Drosophila_2:1635143_at:619:121; Interrogation_Position=735; Antisense; AGCGGTGACTCTGTGCTCCATACAC
>probe:Drosophila_2:1635143_at:226:489; Interrogation_Position=764; Antisense; GTACGACCTGCACATCAGCTATGAT
>probe:Drosophila_2:1635143_at:183:31; Interrogation_Position=787; Antisense; ATAAGTACTATCAGACGCCGCGACT
>probe:Drosophila_2:1635143_at:65:607; Interrogation_Position=827; Antisense; TGATGAGCAGCGCAAGCCACTGACC
>probe:Drosophila_2:1635143_at:705:77; Interrogation_Position=868; Antisense; AGGATGTCTCGCAGGATCACGCGAA
>probe:Drosophila_2:1635143_at:62:389; Interrogation_Position=893; Antisense; GAAAACTGTCACCATGGAGTCCCAT
>probe:Drosophila_2:1635143_at:119:81; Interrogation_Position=929; Antisense; AGGTCCCAATATGGCCTCTGTGCAT
>probe:Drosophila_2:1635143_at:401:509; Interrogation_Position=948; Antisense; GTGCATCCATGTCGGCATGCGGATA

Paste this into a BLAST search page for me
CGGTCAGCTGGGAGTGCATTTATACATTCCTCAAATTCGTTCAGACCGTCAGACCGTCATACCAACCATCGAATATCAACATGTCTTAAGACCCGCCATGGACCCGCCATGCTTTTCAATATTGAACGATTTCGAGGAGAGCGGCATGCTAGCGGTGACTCTGTGCTCCATACACGTACGACCTGCACATCAGCTATGATATAAGTACTATCAGACGCCGCGACTTGATGAGCAGCGCAAGCCACTGACCAGGATGTCTCGCAGGATCACGCGAAGAAAACTGTCACCATGGAGTCCCATAGGTCCCAATATGGCCTCTGTGCATGTGCATCCATGTCGGCATGCGGATA

Full Affymetrix probeset data:

Annotations for 1635143_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720