Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635144_at:

>probe:Drosophila_2:1635144_at:501:433; Interrogation_Position=3463; Antisense; GAGTGTTACGAACCCAGCAGGCATT
>probe:Drosophila_2:1635144_at:371:701; Interrogation_Position=3486; Antisense; TTTTATCAGCTTTTGCACCTTTCCA
>probe:Drosophila_2:1635144_at:256:261; Interrogation_Position=3501; Antisense; CACCTTTCCAATTGTACGATCCGAA
>probe:Drosophila_2:1635144_at:142:449; Interrogation_Position=3518; Antisense; GATCCGAATCCGTACTGTTTCATTT
>probe:Drosophila_2:1635144_at:165:489; Interrogation_Position=3529; Antisense; GTACTGTTTCATTTAGGGCACACAA
>probe:Drosophila_2:1635144_at:398:725; Interrogation_Position=3571; Antisense; TTGTATATTTGATAGGCCGCGGCCT
>probe:Drosophila_2:1635144_at:3:661; Interrogation_Position=3595; Antisense; TACAACTCGAACTCGTACACAACTC
>probe:Drosophila_2:1635144_at:486:191; Interrogation_Position=3615; Antisense; AACTCCCTGTACTTAGCATGTCGAT
>probe:Drosophila_2:1635144_at:261:347; Interrogation_Position=3630; Antisense; GCATGTCGATCGAACGAGGCCAAAA
>probe:Drosophila_2:1635144_at:562:513; Interrogation_Position=3748; Antisense; GTGTACCTTACATAGCCAGTTGAAT
>probe:Drosophila_2:1635144_at:443:555; Interrogation_Position=3776; Antisense; GGACGAATCGGAGGCATTACTACAG
>probe:Drosophila_2:1635144_at:592:531; Interrogation_Position=3846; Antisense; GGGTCCGAAAAGGATCCAGCCTGAA
>probe:Drosophila_2:1635144_at:425:19; Interrogation_Position=3902; Antisense; ATATAGCTAAGCACGTGACCGGTAC
>probe:Drosophila_2:1635144_at:590:511; Interrogation_Position=3916; Antisense; GTGACCGGTACGTGTTCATAAAAAG

Paste this into a BLAST search page for me
GAGTGTTACGAACCCAGCAGGCATTTTTTATCAGCTTTTGCACCTTTCCACACCTTTCCAATTGTACGATCCGAAGATCCGAATCCGTACTGTTTCATTTGTACTGTTTCATTTAGGGCACACAATTGTATATTTGATAGGCCGCGGCCTTACAACTCGAACTCGTACACAACTCAACTCCCTGTACTTAGCATGTCGATGCATGTCGATCGAACGAGGCCAAAAGTGTACCTTACATAGCCAGTTGAATGGACGAATCGGAGGCATTACTACAGGGGTCCGAAAAGGATCCAGCCTGAAATATAGCTAAGCACGTGACCGGTACGTGACCGGTACGTGTTCATAAAAAG

Full Affymetrix probeset data:

Annotations for 1635144_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime