FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635147_at:

>probe:Drosophila_2:1635147_at:219:393; Interrogation_Position=124; Antisense; GAAAGACTGCAACTCTATTTCATTA
>probe:Drosophila_2:1635147_at:696:405; Interrogation_Position=128; Antisense; GACTGCAACTCTATTTCATTAAGAA
>probe:Drosophila_2:1635147_at:327:67; Interrogation_Position=13; Antisense; ATGGCGGGCAACAGTCGCAATTCGT
>probe:Drosophila_2:1635147_at:387:689; Interrogation_Position=139; Antisense; TATTTCATTAAGAATCAGCGTTCAA
>probe:Drosophila_2:1635147_at:516:525; Interrogation_Position=18; Antisense; GGGCAACAGTCGCAATTCGTCCTAC
>probe:Drosophila_2:1635147_at:316:189; Interrogation_Position=22; Antisense; AACAGTCGCAATTCGTCCTACAATT
>probe:Drosophila_2:1635147_at:236:247; Interrogation_Position=31; Antisense; AATTCGTCCTACAATTGTCTCTCCT
>probe:Drosophila_2:1635147_at:378:665; Interrogation_Position=40; Antisense; TACAATTGTCTCTCCTCGTGGGACT
>probe:Drosophila_2:1635147_at:262:631; Interrogation_Position=52; Antisense; TCCTCGTGGGACTCCTATGATCGAA
>probe:Drosophila_2:1635147_at:242:285; Interrogation_Position=56; Antisense; CGTGGGACTCCTATGATCGAATACC
>probe:Drosophila_2:1635147_at:441:555; Interrogation_Position=60; Antisense; GGACTCCTATGATCGAATACCCAGA
>probe:Drosophila_2:1635147_at:148:681; Interrogation_Position=67; Antisense; TATGATCGAATACCCAGAGTTCGGG
>probe:Drosophila_2:1635147_at:514:301; Interrogation_Position=79; Antisense; CCCAGAGTTCGGGTGGAGTACTATG
>probe:Drosophila_2:1635147_at:392:91; Interrogation_Position=84; Antisense; AGTTCGGGTGGAGTACTATGTGAAC

Paste this into a BLAST search page for me
GAAAGACTGCAACTCTATTTCATTAGACTGCAACTCTATTTCATTAAGAAATGGCGGGCAACAGTCGCAATTCGTTATTTCATTAAGAATCAGCGTTCAAGGGCAACAGTCGCAATTCGTCCTACAACAGTCGCAATTCGTCCTACAATTAATTCGTCCTACAATTGTCTCTCCTTACAATTGTCTCTCCTCGTGGGACTTCCTCGTGGGACTCCTATGATCGAACGTGGGACTCCTATGATCGAATACCGGACTCCTATGATCGAATACCCAGATATGATCGAATACCCAGAGTTCGGGCCCAGAGTTCGGGTGGAGTACTATGAGTTCGGGTGGAGTACTATGTGAAC

Full Affymetrix probeset data:

Annotations for 1635147_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720