FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635148_at:

>probe:Drosophila_2:1635148_at:486:219; Interrogation_Position=1351; Antisense; AAGTCGCGTGGATCTGTGGGACTCC
>probe:Drosophila_2:1635148_at:15:529; Interrogation_Position=1368; Antisense; GGGACTCCTTAACAGACACATGCGA
>probe:Drosophila_2:1635148_at:268:19; Interrogation_Position=1450; Antisense; ATTTCCGCCATTCGAAGTGCAGTCG
>probe:Drosophila_2:1635148_at:323:85; Interrogation_Position=1465; Antisense; AGTGCAGTCGAGCTGGTCAACTCTA
>probe:Drosophila_2:1635148_at:396:191; Interrogation_Position=1546; Antisense; AACTTTGGTCCCTTCGAGCGAGATT
>probe:Drosophila_2:1635148_at:651:415; Interrogation_Position=1561; Antisense; GAGCGAGATTTCTTCGACAACCGTC
>probe:Drosophila_2:1635148_at:631:241; Interrogation_Position=1595; Antisense; AATACCTGGAGTGTCTGATGCGGCA
>probe:Drosophila_2:1635148_at:53:53; Interrogation_Position=1612; Antisense; ATGCGGCACGTTGGCTTGGGATCCC
>probe:Drosophila_2:1635148_at:431:725; Interrogation_Position=1627; Antisense; TTGGGATCCCATCATCCGGGTGGAA
>probe:Drosophila_2:1635148_at:727:351; Interrogation_Position=1664; Antisense; GCAGCGTTGTGGACTCGCAATTAAG
>probe:Drosophila_2:1635148_at:460:483; Interrogation_Position=1717; Antisense; GTAGATGCTAGTGTACTACCCCGTC
>probe:Drosophila_2:1635148_at:216:103; Interrogation_Position=1786; Antisense; AGAGCCGCCTCTTGGATTCTGAAGA
>probe:Drosophila_2:1635148_at:222:195; Interrogation_Position=1814; Antisense; AACTGCAGGCCGGTGATTCGAAATG
>probe:Drosophila_2:1635148_at:400:467; Interrogation_Position=1877; Antisense; GTTGAGGGACAACCGCACTGAACAA

Paste this into a BLAST search page for me
AAGTCGCGTGGATCTGTGGGACTCCGGGACTCCTTAACAGACACATGCGAATTTCCGCCATTCGAAGTGCAGTCGAGTGCAGTCGAGCTGGTCAACTCTAAACTTTGGTCCCTTCGAGCGAGATTGAGCGAGATTTCTTCGACAACCGTCAATACCTGGAGTGTCTGATGCGGCAATGCGGCACGTTGGCTTGGGATCCCTTGGGATCCCATCATCCGGGTGGAAGCAGCGTTGTGGACTCGCAATTAAGGTAGATGCTAGTGTACTACCCCGTCAGAGCCGCCTCTTGGATTCTGAAGAAACTGCAGGCCGGTGATTCGAAATGGTTGAGGGACAACCGCACTGAACAA

Full Affymetrix probeset data:

Annotations for 1635148_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720