FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635149_at:

>probe:Drosophila_2:1635149_at:36:291; Interrogation_Position=122; Antisense; CGGAGATTTTTGTACCCCAGATATA
>probe:Drosophila_2:1635149_at:719:27; Interrogation_Position=175; Antisense; ATACGAGATCGTCGGTCGAATCCAA
>probe:Drosophila_2:1635149_at:394:245; Interrogation_Position=206; Antisense; AATTTTGTGAAGAGCCTGTCCAGGG
>probe:Drosophila_2:1635149_at:8:131; Interrogation_Position=270; Antisense; ACCTCGGATAACGACGGCGACGGCA
>probe:Drosophila_2:1635149_at:560:329; Interrogation_Position=313; Antisense; GCGTCCATCGATGGCAGTCCATTTA
>probe:Drosophila_2:1635149_at:669:533; Interrogation_Position=362; Antisense; GGTGTCCACTGTTTTCACTCAAGCT
>probe:Drosophila_2:1635149_at:417:697; Interrogation_Position=374; Antisense; TTTCACTCAAGCTCATCTCGAATGG
>probe:Drosophila_2:1635149_at:502:643; Interrogation_Position=389; Antisense; TCTCGAATGGCAGCGTAGTGCTCGT
>probe:Drosophila_2:1635149_at:146:551; Interrogation_Position=435; Antisense; GGAGATCTTTCTACCGCAGATTTGC
>probe:Drosophila_2:1635149_at:623:459; Interrogation_Position=453; Antisense; GATTTGCGGCCAGTACATAGCCATG
>probe:Drosophila_2:1635149_at:197:5; Interrogation_Position=551; Antisense; ATTGTTTACGCATTCAACCGACTCG
>probe:Drosophila_2:1635149_at:216:635; Interrogation_Position=564; Antisense; TCAACCGACTCGCTTCTTTTCAAAA
>probe:Drosophila_2:1635149_at:613:357; Interrogation_Position=642; Antisense; GCAAACCAATCACTCTGGAGCTGGG
>probe:Drosophila_2:1635149_at:145:503; Interrogation_Position=684; Antisense; GTCCGTGAAACGATAACCCCATGGC

Paste this into a BLAST search page for me
CGGAGATTTTTGTACCCCAGATATAATACGAGATCGTCGGTCGAATCCAAAATTTTGTGAAGAGCCTGTCCAGGGACCTCGGATAACGACGGCGACGGCAGCGTCCATCGATGGCAGTCCATTTAGGTGTCCACTGTTTTCACTCAAGCTTTTCACTCAAGCTCATCTCGAATGGTCTCGAATGGCAGCGTAGTGCTCGTGGAGATCTTTCTACCGCAGATTTGCGATTTGCGGCCAGTACATAGCCATGATTGTTTACGCATTCAACCGACTCGTCAACCGACTCGCTTCTTTTCAAAAGCAAACCAATCACTCTGGAGCTGGGGTCCGTGAAACGATAACCCCATGGC

Full Affymetrix probeset data:

Annotations for 1635149_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720