FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635151_at:

>probe:Drosophila_2:1635151_at:263:95; Interrogation_Position=307; Antisense; AGATTATACGCGTCGATCATGCCGG
>probe:Drosophila_2:1635151_at:277:115; Interrogation_Position=341; Antisense; AGCAGATCGCATTTACGCCGGGCAA
>probe:Drosophila_2:1635151_at:182:167; Interrogation_Position=364; Antisense; AAATGGCCATTCTGGGCAACGGACC
>probe:Drosophila_2:1635151_at:728:593; Interrogation_Position=391; Antisense; TGGGCAAGACCATCGGACACATGTG
>probe:Drosophila_2:1635151_at:550:471; Interrogation_Position=443; Antisense; GTTCGAGCAGCTCATTCAACAGCAC
>probe:Drosophila_2:1635151_at:650:505; Interrogation_Position=475; Antisense; GTCCAACGATCATGACGCCAATTTG
>probe:Drosophila_2:1635151_at:647:145; Interrogation_Position=493; Antisense; CAATTTGGAACGTGGCCGGATTTGT
>probe:Drosophila_2:1635151_at:306:107; Interrogation_Position=593; Antisense; AGAACACTACAATGACCAGCTGCGT
>probe:Drosophila_2:1635151_at:680:199; Interrogation_Position=636; Antisense; AACCCGGATAAGGAGCTGTTGGCCA
>probe:Drosophila_2:1635151_at:639:129; Interrogation_Position=660; Antisense; ACCATCACCAAGTTCCGGGACGAGG
>probe:Drosophila_2:1635151_at:574:551; Interrogation_Position=689; Antisense; GGAGCACCACGACACGGGCATTGAT
>probe:Drosophila_2:1635151_at:581:5; Interrogation_Position=708; Antisense; ATTGATCACGGTGCCGAGCAAGCGC
>probe:Drosophila_2:1635151_at:2:253; Interrogation_Position=761; Antisense; CAAGTTTGGCTGCAAGACGGCTATT
>probe:Drosophila_2:1635151_at:14:669; Interrogation_Position=847; Antisense; TATCTGTTCCGCTAAGCTAACCGTG

Paste this into a BLAST search page for me
AGATTATACGCGTCGATCATGCCGGAGCAGATCGCATTTACGCCGGGCAAAAATGGCCATTCTGGGCAACGGACCTGGGCAAGACCATCGGACACATGTGGTTCGAGCAGCTCATTCAACAGCACGTCCAACGATCATGACGCCAATTTGCAATTTGGAACGTGGCCGGATTTGTAGAACACTACAATGACCAGCTGCGTAACCCGGATAAGGAGCTGTTGGCCAACCATCACCAAGTTCCGGGACGAGGGGAGCACCACGACACGGGCATTGATATTGATCACGGTGCCGAGCAAGCGCCAAGTTTGGCTGCAAGACGGCTATTTATCTGTTCCGCTAAGCTAACCGTG

Full Affymetrix probeset data:

Annotations for 1635151_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720