Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635152_at:

>probe:Drosophila_2:1635152_at:298:59; Interrogation_Position=1347; Antisense; ATGATCTTCATTTGCGCGACGGAAA
>probe:Drosophila_2:1635152_at:681:373; Interrogation_Position=1386; Antisense; GAAGTTATTGGCCACATCCTGAAGG
>probe:Drosophila_2:1635152_at:335:73; Interrogation_Position=1414; Antisense; AGGACGACTTTATGGGCGCAACGGT
>probe:Drosophila_2:1635152_at:519:373; Interrogation_Position=1453; Antisense; GAAGTCTGGGTCCACTAATTGCCAA
>probe:Drosophila_2:1635152_at:62:585; Interrogation_Position=1486; Antisense; TGGCATTGCACGGATATCCCAGGAT
>probe:Drosophila_2:1635152_at:1:599; Interrogation_Position=1550; Antisense; TGTCATGTCCGCCAGCACTGTGATG
>probe:Drosophila_2:1635152_at:611:599; Interrogation_Position=1577; Antisense; TGTCAAGAATCTATTTGGCCTCCCG
>probe:Drosophila_2:1635152_at:444:343; Interrogation_Position=1641; Antisense; GCATTCATTTTTCTAAACCTGGGTG
>probe:Drosophila_2:1635152_at:7:513; Interrogation_Position=1665; Antisense; GTGTTTTCCACTCTTCTATGGTCCA
>probe:Drosophila_2:1635152_at:296:681; Interrogation_Position=1681; Antisense; TATGGTCCACGACGCTGGGATTTTT
>probe:Drosophila_2:1635152_at:337:335; Interrogation_Position=1714; Antisense; GCTCCGTGGGCATATTTTCTATCGT
>probe:Drosophila_2:1635152_at:50:665; Interrogation_Position=1752; Antisense; TACTTGCTTTTTGCTATCCTAATTC
>probe:Drosophila_2:1635152_at:323:149; Interrogation_Position=1790; Antisense; ACATTCGTTTTCTGTGGACTTGCCA
>probe:Drosophila_2:1635152_at:674:493; Interrogation_Position=1815; Antisense; GTCAAGGCAGCATTCGGTGATATCT

Paste this into a BLAST search page for me
ATGATCTTCATTTGCGCGACGGAAAGAAGTTATTGGCCACATCCTGAAGGAGGACGACTTTATGGGCGCAACGGTGAAGTCTGGGTCCACTAATTGCCAATGGCATTGCACGGATATCCCAGGATTGTCATGTCCGCCAGCACTGTGATGTGTCAAGAATCTATTTGGCCTCCCGGCATTCATTTTTCTAAACCTGGGTGGTGTTTTCCACTCTTCTATGGTCCATATGGTCCACGACGCTGGGATTTTTGCTCCGTGGGCATATTTTCTATCGTTACTTGCTTTTTGCTATCCTAATTCACATTCGTTTTCTGTGGACTTGCCAGTCAAGGCAGCATTCGGTGATATCT

Full Affymetrix probeset data:

Annotations for 1635152_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime