FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635153_at:

>probe:Drosophila_2:1635153_at:60:587; Interrogation_Position=1988; Antisense; TGGACAAGGAGATGCCCGTGCTGAT
>probe:Drosophila_2:1635153_at:263:43; Interrogation_Position=2014; Antisense; ATCGTGCTGCGGGATCCGGTGTACA
>probe:Drosophila_2:1635153_at:480:143; Interrogation_Position=2055; Antisense; ACTGCAGCAGGTGACGTCCCGCAAG
>probe:Drosophila_2:1635153_at:291:83; Interrogation_Position=2078; Antisense; AGGGCAGACCGATCCTAATCTGCGA
>probe:Drosophila_2:1635153_at:449:81; Interrogation_Position=2105; Antisense; AGGGCGACAACGAGACCATGTCCTT
>probe:Drosophila_2:1635153_at:153:193; Interrogation_Position=2294; Antisense; AACTATCTGGCTAACTGGCTCGCAC
>probe:Drosophila_2:1635153_at:199:635; Interrogation_Position=2313; Antisense; TCGCACCGTCTCAAGAATTCCATTT
>probe:Drosophila_2:1635153_at:296:247; Interrogation_Position=2328; Antisense; AATTCCATTTTAGTATCTGCCTGAG
>probe:Drosophila_2:1635153_at:286:245; Interrogation_Position=2385; Antisense; AATTTTCTGGTATTTTGTCGGATCA
>probe:Drosophila_2:1635153_at:136:21; Interrogation_Position=2429; Antisense; ATTTGTGCTCCTTCTGGCTGAAGCC
>probe:Drosophila_2:1635153_at:438:379; Interrogation_Position=2448; Antisense; GAAGCCACATATGTTTAACCCCTAC
>probe:Drosophila_2:1635153_at:351:147; Interrogation_Position=2471; Antisense; ACATTTGTAGCTGTACTGACCCTTT
>probe:Drosophila_2:1635153_at:351:135; Interrogation_Position=2485; Antisense; ACTGACCCTTTGTGTTGTGGACCCA
>probe:Drosophila_2:1635153_at:338:519; Interrogation_Position=2501; Antisense; GTGGACCCACTACTTTTTGTGAATG

Paste this into a BLAST search page for me
TGGACAAGGAGATGCCCGTGCTGATATCGTGCTGCGGGATCCGGTGTACAACTGCAGCAGGTGACGTCCCGCAAGAGGGCAGACCGATCCTAATCTGCGAAGGGCGACAACGAGACCATGTCCTTAACTATCTGGCTAACTGGCTCGCACTCGCACCGTCTCAAGAATTCCATTTAATTCCATTTTAGTATCTGCCTGAGAATTTTCTGGTATTTTGTCGGATCAATTTGTGCTCCTTCTGGCTGAAGCCGAAGCCACATATGTTTAACCCCTACACATTTGTAGCTGTACTGACCCTTTACTGACCCTTTGTGTTGTGGACCCAGTGGACCCACTACTTTTTGTGAATG

Full Affymetrix probeset data:

Annotations for 1635153_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720