Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635157_at:

>probe:Drosophila_2:1635157_at:719:215; Interrogation_Position=2972; Antisense; AAGTTGACTAAACGATTTCTTGGCA
>probe:Drosophila_2:1635157_at:282:611; Interrogation_Position=2976; Antisense; TGACTAAACGATTTCTTGGCAAAAG
>probe:Drosophila_2:1635157_at:129:461; Interrogation_Position=2985; Antisense; GATTTCTTGGCAAAAGTCTCTTGGA
>probe:Drosophila_2:1635157_at:351:645; Interrogation_Position=2989; Antisense; TCTTGGCAAAAGTCTCTTGGAGCAG
>probe:Drosophila_2:1635157_at:659:357; Interrogation_Position=2994; Antisense; GCAAAAGTCTCTTGGAGCAGGGAGA
>probe:Drosophila_2:1635157_at:425:273; Interrogation_Position=3004; Antisense; CTTGGAGCAGGGAGAAATTATTTAC
>probe:Drosophila_2:1635157_at:700:393; Interrogation_Position=3017; Antisense; GAAATTATTTACAAGGGCGACAACA
>probe:Drosophila_2:1635157_at:48:525; Interrogation_Position=3031; Antisense; GGGCGACAACAAAGCTTATCTAAAT
>probe:Drosophila_2:1635157_at:555:397; Interrogation_Position=3035; Antisense; GACAACAAAGCTTATCTAAATCATT
>probe:Drosophila_2:1635157_at:193:165; Interrogation_Position=3052; Antisense; AAATCATTTACAAGTGTGTGTCTGA
>probe:Drosophila_2:1635157_at:583:251; Interrogation_Position=3062; Antisense; CAAGTGTGTGTCTGAAACTCCCCAA
>probe:Drosophila_2:1635157_at:532:595; Interrogation_Position=3066; Antisense; TGTGTGTCTGAAACTCCCCAAGAAT
>probe:Drosophila_2:1635157_at:588:513; Interrogation_Position=3069; Antisense; GTGTCTGAAACTCCCCAAGAATAAT
>probe:Drosophila_2:1635157_at:251:611; Interrogation_Position=3074; Antisense; TGAAACTCCCCAAGAATAATAAAGA

Paste this into a BLAST search page for me
AAGTTGACTAAACGATTTCTTGGCATGACTAAACGATTTCTTGGCAAAAGGATTTCTTGGCAAAAGTCTCTTGGATCTTGGCAAAAGTCTCTTGGAGCAGGCAAAAGTCTCTTGGAGCAGGGAGACTTGGAGCAGGGAGAAATTATTTACGAAATTATTTACAAGGGCGACAACAGGGCGACAACAAAGCTTATCTAAATGACAACAAAGCTTATCTAAATCATTAAATCATTTACAAGTGTGTGTCTGACAAGTGTGTGTCTGAAACTCCCCAATGTGTGTCTGAAACTCCCCAAGAATGTGTCTGAAACTCCCCAAGAATAATTGAAACTCCCCAAGAATAATAAAGA

Full Affymetrix probeset data:

Annotations for 1635157_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime