FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635158_at:

>probe:Drosophila_2:1635158_at:584:497; Interrogation_Position=1035; Antisense; GTCTCCTTCGGTGCGGATGAACTAC
>probe:Drosophila_2:1635158_at:304:383; Interrogation_Position=1053; Antisense; GAACTACAAGATCTGCTGCGAGCAC
>probe:Drosophila_2:1635158_at:720:111; Interrogation_Position=1073; Antisense; AGCACCGGCATTCGATTCAGGGCAA
>probe:Drosophila_2:1635158_at:560:11; Interrogation_Position=1087; Antisense; ATTCAGGGCAAGCTACCCAGGTACA
>probe:Drosophila_2:1635158_at:382:79; Interrogation_Position=1105; Antisense; AGGTACACGGGCTACATGTCCGAGT
>probe:Drosophila_2:1635158_at:260:429; Interrogation_Position=1126; Antisense; GAGTACGGACTGACTGCCCAGCAAC
>probe:Drosophila_2:1635158_at:35:377; Interrogation_Position=1179; Antisense; GAAGCAGCGCTTCTCCATGGAGCAG
>probe:Drosophila_2:1635158_at:56:589; Interrogation_Position=1196; Antisense; TGGAGCAGACCATCAATCGCAACGA
>probe:Drosophila_2:1635158_at:16:99; Interrogation_Position=1235; Antisense; AGATGCAGGACAACGAGCGCGCCTT
>probe:Drosophila_2:1635158_at:453:447; Interrogation_Position=1281; Antisense; GATGCGCTATCCGATCAACAAGACC
>probe:Drosophila_2:1635158_at:469:253; Interrogation_Position=1296; Antisense; CAACAAGACCCGCAACATGTTCGAT
>probe:Drosophila_2:1635158_at:48:41; Interrogation_Position=1472; Antisense; ATCTGCTCGGCAGCTGGAACAAGTA
>probe:Drosophila_2:1635158_at:333:373; Interrogation_Position=907; Antisense; GAAGTCAGGGATTCGTGCACCACAT
>probe:Drosophila_2:1635158_at:463:711; Interrogation_Position=958; Antisense; TTCACTTCGCGCAGTTTTAGCTTTC

Paste this into a BLAST search page for me
GTCTCCTTCGGTGCGGATGAACTACGAACTACAAGATCTGCTGCGAGCACAGCACCGGCATTCGATTCAGGGCAAATTCAGGGCAAGCTACCCAGGTACAAGGTACACGGGCTACATGTCCGAGTGAGTACGGACTGACTGCCCAGCAACGAAGCAGCGCTTCTCCATGGAGCAGTGGAGCAGACCATCAATCGCAACGAAGATGCAGGACAACGAGCGCGCCTTGATGCGCTATCCGATCAACAAGACCCAACAAGACCCGCAACATGTTCGATATCTGCTCGGCAGCTGGAACAAGTAGAAGTCAGGGATTCGTGCACCACATTTCACTTCGCGCAGTTTTAGCTTTC

Full Affymetrix probeset data:

Annotations for 1635158_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720