FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635160_at:

>probe:Drosophila_2:1635160_at:507:331; Interrogation_Position=105; Antisense; GCTGAAGCCGCTTGGTAAGAAGACC
>probe:Drosophila_2:1635160_at:145:125; Interrogation_Position=110; Antisense; AGCCGCTTGGTAAGAAGACCGAGAA
>probe:Drosophila_2:1635160_at:410:615; Interrogation_Position=149; Antisense; TGAAGGAGATCAAGTGCCACAAGGC
>probe:Drosophila_2:1635160_at:262:97; Interrogation_Position=155; Antisense; AGATCAAGTGCCACAAGGCGCACTT
>probe:Drosophila_2:1635160_at:374:575; Interrogation_Position=171; Antisense; GGCGCACTTTAACGAAATGACCGAC
>probe:Drosophila_2:1635160_at:550:697; Interrogation_Position=178; Antisense; TTTAACGAAATGACCGACTGCTTGC
>probe:Drosophila_2:1635160_at:3:413; Interrogation_Position=189; Antisense; GACCGACTGCTTGCATAAGCTTTTG
>probe:Drosophila_2:1635160_at:208:199; Interrogation_Position=19; Antisense; AACGATTCGGATAGAAACGATGGCC
>probe:Drosophila_2:1635160_at:298:343; Interrogation_Position=197; Antisense; GCTTGCATAAGCTTTTGACTCCAGT
>probe:Drosophila_2:1635160_at:30:33; Interrogation_Position=203; Antisense; ATAAGCTTTTGACTCCAGTGACGCC
>probe:Drosophila_2:1635160_at:117:703; Interrogation_Position=209; Antisense; TTTTGACTCCAGTGACGCCCAGTAG
>probe:Drosophila_2:1635160_at:392:611; Interrogation_Position=221; Antisense; TGACGCCCAGTAGCATGACCAAGAA
>probe:Drosophila_2:1635160_at:172:267; Interrogation_Position=228; Antisense; CAGTAGCATGACCAAGAACACGTGA
>probe:Drosophila_2:1635160_at:516:107; Interrogation_Position=89; Antisense; AGAAGAAGAACGGAATGCTGAAGCC

Paste this into a BLAST search page for me
GCTGAAGCCGCTTGGTAAGAAGACCAGCCGCTTGGTAAGAAGACCGAGAATGAAGGAGATCAAGTGCCACAAGGCAGATCAAGTGCCACAAGGCGCACTTGGCGCACTTTAACGAAATGACCGACTTTAACGAAATGACCGACTGCTTGCGACCGACTGCTTGCATAAGCTTTTGAACGATTCGGATAGAAACGATGGCCGCTTGCATAAGCTTTTGACTCCAGTATAAGCTTTTGACTCCAGTGACGCCTTTTGACTCCAGTGACGCCCAGTAGTGACGCCCAGTAGCATGACCAAGAACAGTAGCATGACCAAGAACACGTGAAGAAGAAGAACGGAATGCTGAAGCC

Full Affymetrix probeset data:

Annotations for 1635160_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720