FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635161_at:

>probe:Drosophila_2:1635161_at:559:667; Interrogation_Position=119; Antisense; TACTCCGATGGTGCTCCAAAGGCCG
>probe:Drosophila_2:1635161_at:462:169; Interrogation_Position=136; Antisense; AAAGGCCGCCTGTCGTGACCTGACG
>probe:Drosophila_2:1635161_at:262:141; Interrogation_Position=168; Antisense; ACGGAGCCAAGCTGCAGGTGACCAA
>probe:Drosophila_2:1635161_at:441:633; Interrogation_Position=218; Antisense; TCCCATGTGCGCTCGGATCAAAAGC
>probe:Drosophila_2:1635161_at:317:455; Interrogation_Position=233; Antisense; GATCAAAAGCTGACCCTGACGCTGG
>probe:Drosophila_2:1635161_at:573:575; Interrogation_Position=260; Antisense; GGCGATGAGTTCCTTGGCTTCATGA
>probe:Drosophila_2:1635161_at:339:571; Interrogation_Position=275; Antisense; GGCTTCATGATCCAGGCACGCGATG
>probe:Drosophila_2:1635161_at:419:271; Interrogation_Position=382; Antisense; CATCACCCATCTGAGTGCGCAAAAG
>probe:Drosophila_2:1635161_at:265:611; Interrogation_Position=417; Antisense; TGACCGGCATCACCTTCGACTGGAT
>probe:Drosophila_2:1635161_at:21:263; Interrogation_Position=447; Antisense; CAGCAGGCTACAAGGGCAACGTCAA
>probe:Drosophila_2:1635161_at:659:195; Interrogation_Position=464; Antisense; AACGTCAAGTTCATGGCCACCGTGG
>probe:Drosophila_2:1635161_at:668:615; Interrogation_Position=489; Antisense; TGCAGACCGGATTCGTTTACTGGGT
>probe:Drosophila_2:1635161_at:170:699; Interrogation_Position=504; Antisense; TTTACTGGGTGGGTCGCGTCACAAA
>probe:Drosophila_2:1635161_at:400:657; Interrogation_Position=606; Antisense; TAATGTTCCGATTAGCTTTGGAGCG

Paste this into a BLAST search page for me
TACTCCGATGGTGCTCCAAAGGCCGAAAGGCCGCCTGTCGTGACCTGACGACGGAGCCAAGCTGCAGGTGACCAATCCCATGTGCGCTCGGATCAAAAGCGATCAAAAGCTGACCCTGACGCTGGGGCGATGAGTTCCTTGGCTTCATGAGGCTTCATGATCCAGGCACGCGATGCATCACCCATCTGAGTGCGCAAAAGTGACCGGCATCACCTTCGACTGGATCAGCAGGCTACAAGGGCAACGTCAAAACGTCAAGTTCATGGCCACCGTGGTGCAGACCGGATTCGTTTACTGGGTTTTACTGGGTGGGTCGCGTCACAAATAATGTTCCGATTAGCTTTGGAGCG

Full Affymetrix probeset data:

Annotations for 1635161_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720