FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635163_at:

>probe:Drosophila_2:1635163_at:291:95; Interrogation_Position=1184; Antisense; AGATAATCGCCGTGGATCAAGATCC
>probe:Drosophila_2:1635163_at:113:495; Interrogation_Position=1260; Antisense; GTCAAGACCGATTGGACCGCTCTAT
>probe:Drosophila_2:1635163_at:546:463; Interrogation_Position=1269; Antisense; GATTGGACCGCTCTATCAAAACTTT
>probe:Drosophila_2:1635163_at:512:145; Interrogation_Position=1295; Antisense; ACTCCTACGCAATTGCCTTTGTGAA
>probe:Drosophila_2:1635163_at:643:191; Interrogation_Position=1335; Antisense; AACTCCATCGGATATTTCGGTTACT
>probe:Drosophila_2:1635163_at:413:525; Interrogation_Position=1371; Antisense; GGGCTTGATTAACTTTTCTGGCTAC
>probe:Drosophila_2:1635163_at:490:641; Interrogation_Position=1387; Antisense; TCTGGCTACAGAGTGGAGGACCTTT
>probe:Drosophila_2:1635163_at:34:569; Interrogation_Position=1428; Antisense; TGGAGTTTTATATCCCAACACCAAA
>probe:Drosophila_2:1635163_at:316:233; Interrogation_Position=1468; Antisense; AATCCTTCGGGCGTGGTTATGCTAA
>probe:Drosophila_2:1635163_at:588:551; Interrogation_Position=1495; Antisense; GGAGAAGTTCAGTACCCAGTTGACT
>probe:Drosophila_2:1635163_at:616:21; Interrogation_Position=1530; Antisense; ATATGTTTGTTGAGATCGCCTATGA
>probe:Drosophila_2:1635163_at:642:723; Interrogation_Position=1586; Antisense; TTGAATTCAACCCTTTCTGCGTTAG
>probe:Drosophila_2:1635163_at:569:715; Interrogation_Position=1600; Antisense; TTCTGCGTTAGCGACTGACAATTTA
>probe:Drosophila_2:1635163_at:501:13; Interrogation_Position=1687; Antisense; ATTTCTAAGCCTCTACAAGCCAATG

Paste this into a BLAST search page for me
AGATAATCGCCGTGGATCAAGATCCGTCAAGACCGATTGGACCGCTCTATGATTGGACCGCTCTATCAAAACTTTACTCCTACGCAATTGCCTTTGTGAAAACTCCATCGGATATTTCGGTTACTGGGCTTGATTAACTTTTCTGGCTACTCTGGCTACAGAGTGGAGGACCTTTTGGAGTTTTATATCCCAACACCAAAAATCCTTCGGGCGTGGTTATGCTAAGGAGAAGTTCAGTACCCAGTTGACTATATGTTTGTTGAGATCGCCTATGATTGAATTCAACCCTTTCTGCGTTAGTTCTGCGTTAGCGACTGACAATTTAATTTCTAAGCCTCTACAAGCCAATG

Full Affymetrix probeset data:

Annotations for 1635163_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720