Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635168_at:

>probe:Drosophila_2:1635168_at:366:135; Interrogation_Position=1267; Antisense; ACGAATCAACAAAACTGCCCGAGGA
>probe:Drosophila_2:1635168_at:218:479; Interrogation_Position=1349; Antisense; GTTTCCGCGACCGATTTTGATCAAG
>probe:Drosophila_2:1635168_at:88:379; Interrogation_Position=1377; Antisense; GAACCTGAGGCGACGGTCAAAGAAC
>probe:Drosophila_2:1635168_at:225:191; Interrogation_Position=1407; Antisense; AACATTGAGTGCGTCGAGTGCGAAA
>probe:Drosophila_2:1635168_at:248:347; Interrogation_Position=1499; Antisense; GCATGAAGACGCTCGCAGTTCAACT
>probe:Drosophila_2:1635168_at:642:191; Interrogation_Position=1520; Antisense; AACTCCGCCGGGATTCTGGAATCCA
>probe:Drosophila_2:1635168_at:408:257; Interrogation_Position=1543; Antisense; CACACATGGTTTCCTTCGCAGAAGG
>probe:Drosophila_2:1635168_at:603:369; Interrogation_Position=1563; Antisense; GAAGGCGATCCACGCAACGAAGTGT
>probe:Drosophila_2:1635168_at:710:15; Interrogation_Position=1590; Antisense; ATAGACACTCGGTTTTGGGACCAGA
>probe:Drosophila_2:1635168_at:293:709; Interrogation_Position=1715; Antisense; TTGATTCACAAGTTTCCTCGCTTGG
>probe:Drosophila_2:1635168_at:373:303; Interrogation_Position=1730; Antisense; CCTCGCTTGGCTTGTTCAATTTCAA
>probe:Drosophila_2:1635168_at:326:653; Interrogation_Position=1751; Antisense; TCAATGGCCGTGAACAAGGACTTAA
>probe:Drosophila_2:1635168_at:489:223; Interrogation_Position=1766; Antisense; AAGGACTTAAAGTTGCCAGCGCCAA
>probe:Drosophila_2:1635168_at:279:453; Interrogation_Position=1808; Antisense; GATCATGATTTACTTGTTCTTAGCA

Paste this into a BLAST search page for me
ACGAATCAACAAAACTGCCCGAGGAGTTTCCGCGACCGATTTTGATCAAGGAACCTGAGGCGACGGTCAAAGAACAACATTGAGTGCGTCGAGTGCGAAAGCATGAAGACGCTCGCAGTTCAACTAACTCCGCCGGGATTCTGGAATCCACACACATGGTTTCCTTCGCAGAAGGGAAGGCGATCCACGCAACGAAGTGTATAGACACTCGGTTTTGGGACCAGATTGATTCACAAGTTTCCTCGCTTGGCCTCGCTTGGCTTGTTCAATTTCAATCAATGGCCGTGAACAAGGACTTAAAAGGACTTAAAGTTGCCAGCGCCAAGATCATGATTTACTTGTTCTTAGCA

Full Affymetrix probeset data:

Annotations for 1635168_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime