Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635170_at:

>probe:Drosophila_2:1635170_at:568:469; Interrogation_Position=1367; Antisense; GTTCCAAGTCGATGAGCTACCTGAT
>probe:Drosophila_2:1635170_at:565:145; Interrogation_Position=1411; Antisense; ACTACATTTTTGGTCGTCCTGTTCT
>probe:Drosophila_2:1635170_at:348:261; Interrogation_Position=1524; Antisense; CACCATCTACTGCTATTTGTGGGAT
>probe:Drosophila_2:1635170_at:649:703; Interrogation_Position=1550; Antisense; TTATTCGCGACTTTGGGCTCTTCAG
>probe:Drosophila_2:1635170_at:461:571; Interrogation_Position=1565; Antisense; GGCTCTTCAGGATTATGCGCGGCGA
>probe:Drosophila_2:1635170_at:151:331; Interrogation_Position=1583; Antisense; GCGGCGAGCGTATATTCCTTCGAAA
>probe:Drosophila_2:1635170_at:492:109; Interrogation_Position=1607; Antisense; AGCAATTGGTTTATCCGCAGGCCTT
>probe:Drosophila_2:1635170_at:99:349; Interrogation_Position=1623; Antisense; GCAGGCCTTCTACTACTTTGTAATC
>probe:Drosophila_2:1635170_at:604:421; Interrogation_Position=1651; Antisense; GAGAATCTGGTGTTGCGGCTCTTTT
>probe:Drosophila_2:1635170_at:640:723; Interrogation_Position=1682; Antisense; TTGAGTTCACCATCCTTTATCACAA
>probe:Drosophila_2:1635170_at:404:607; Interrogation_Position=1727; Antisense; TGAGGACCATTTCCAGTATCCTGGA
>probe:Drosophila_2:1635170_at:521:47; Interrogation_Position=1744; Antisense; ATCCTGGAGATCACTAGACGCTTCA
>probe:Drosophila_2:1635170_at:213:681; Interrogation_Position=1769; Antisense; TATGGAACTACGTCCGTCTCGAGAA
>probe:Drosophila_2:1635170_at:509:385; Interrogation_Position=1795; Antisense; GAACACTTGTTCAACTGCGGAAACT

Paste this into a BLAST search page for me
GTTCCAAGTCGATGAGCTACCTGATACTACATTTTTGGTCGTCCTGTTCTCACCATCTACTGCTATTTGTGGGATTTATTCGCGACTTTGGGCTCTTCAGGGCTCTTCAGGATTATGCGCGGCGAGCGGCGAGCGTATATTCCTTCGAAAAGCAATTGGTTTATCCGCAGGCCTTGCAGGCCTTCTACTACTTTGTAATCGAGAATCTGGTGTTGCGGCTCTTTTTTGAGTTCACCATCCTTTATCACAATGAGGACCATTTCCAGTATCCTGGAATCCTGGAGATCACTAGACGCTTCATATGGAACTACGTCCGTCTCGAGAAGAACACTTGTTCAACTGCGGAAACT

Full Affymetrix probeset data:

Annotations for 1635170_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime