FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635173_at:

>probe:Drosophila_2:1635173_at:18:447; Interrogation_Position=3726; Antisense; GATGCATAACCTGACTACGAGCGAA
>probe:Drosophila_2:1635173_at:206:417; Interrogation_Position=3744; Antisense; GAGCGAAATTCCACAGATGATCATT
>probe:Drosophila_2:1635173_at:596:253; Interrogation_Position=3777; Antisense; CAAACCGATAAGACGCAGGCCAAGT
>probe:Drosophila_2:1635173_at:432:57; Interrogation_Position=3838; Antisense; ATGTGTGACGAACCCATAGTTATAG
>probe:Drosophila_2:1635173_at:414:137; Interrogation_Position=3867; Antisense; ACGACGATATATACACATACGGCAA
>probe:Drosophila_2:1635173_at:162:665; Interrogation_Position=3894; Antisense; TAGCAACTATTTTAACTGGTGACGG
>probe:Drosophila_2:1635173_at:598:141; Interrogation_Position=3908; Antisense; ACTGGTGACGGTGCAATTTTTAATT
>probe:Drosophila_2:1635173_at:187:447; Interrogation_Position=3958; Antisense; GATCCAACAAAGCAGGCAGGTTCAA
>probe:Drosophila_2:1635173_at:55:541; Interrogation_Position=3976; Antisense; GGTTCAACGACCCACAACAATCGAA
>probe:Drosophila_2:1635173_at:422:13; Interrogation_Position=4020; Antisense; ATTACAAATGTCGTGTGACCGCTAG
>probe:Drosophila_2:1635173_at:38:413; Interrogation_Position=4036; Antisense; GACCGCTAGATATGGCCTACACTAT
>probe:Drosophila_2:1635173_at:177:27; Interrogation_Position=4069; Antisense; ATAGCTGCCTCTATGTTTCATATTG
>probe:Drosophila_2:1635173_at:261:23; Interrogation_Position=4117; Antisense; ATAGGTTTCCCATTACTCAAATTGT
>probe:Drosophila_2:1635173_at:371:491; Interrogation_Position=4199; Antisense; GTAAGCCAACATTTTTTATGCATTT

Paste this into a BLAST search page for me
GATGCATAACCTGACTACGAGCGAAGAGCGAAATTCCACAGATGATCATTCAAACCGATAAGACGCAGGCCAAGTATGTGTGACGAACCCATAGTTATAGACGACGATATATACACATACGGCAATAGCAACTATTTTAACTGGTGACGGACTGGTGACGGTGCAATTTTTAATTGATCCAACAAAGCAGGCAGGTTCAAGGTTCAACGACCCACAACAATCGAAATTACAAATGTCGTGTGACCGCTAGGACCGCTAGATATGGCCTACACTATATAGCTGCCTCTATGTTTCATATTGATAGGTTTCCCATTACTCAAATTGTGTAAGCCAACATTTTTTATGCATTT

Full Affymetrix probeset data:

Annotations for 1635173_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720