Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635175_at:

>probe:Drosophila_2:1635175_at:623:607; Interrogation_Position=1013; Antisense; TGAGGACCAGCGGAGATCTTCCACT
>probe:Drosophila_2:1635175_at:130:199; Interrogation_Position=1123; Antisense; AACGAGCGCATGGTGTATGTGCCAA
>probe:Drosophila_2:1635175_at:449:355; Interrogation_Position=1156; Antisense; GCACTCAGTGTATGGCTGCTCAGAC
>probe:Drosophila_2:1635175_at:320:77; Interrogation_Position=1199; Antisense; AGGATTACATGCTGCTTCGCTTCTA
>probe:Drosophila_2:1635175_at:340:337; Interrogation_Position=1241; Antisense; GCTCCCACCTGTTTTACTGGAAGTA
>probe:Drosophila_2:1635175_at:69:375; Interrogation_Position=1295; Antisense; GAAGCATTTACTCCTGTTTGTTTCC
>probe:Drosophila_2:1635175_at:214:481; Interrogation_Position=1310; Antisense; GTTTGTTTCCCAATTGCAGTTCTTT
>probe:Drosophila_2:1635175_at:674:193; Interrogation_Position=1339; Antisense; AACTGTTGCTTACGCTAGGTGTACA
>probe:Drosophila_2:1635175_at:491:361; Interrogation_Position=836; Antisense; GCAAGTCCGGTCATCTGGTGGCAGT
>probe:Drosophila_2:1635175_at:424:565; Interrogation_Position=855; Antisense; GGCAGTAAATGCCTTAGCGGGTCTA
>probe:Drosophila_2:1635175_at:544:121; Interrogation_Position=870; Antisense; AGCGGGTCTAGTTCCACTGCCAGGA
>probe:Drosophila_2:1635175_at:365:83; Interrogation_Position=929; Antisense; AGGGCTTCATGGAATCGCTGCGAGC
>probe:Drosophila_2:1635175_at:263:325; Interrogation_Position=948; Antisense; GCGAGCTGAGCTGCGATTGTCCGAC
>probe:Drosophila_2:1635175_at:509:3; Interrogation_Position=963; Antisense; ATTGTCCGACTGTGACTACGTTCGC

Paste this into a BLAST search page for me
TGAGGACCAGCGGAGATCTTCCACTAACGAGCGCATGGTGTATGTGCCAAGCACTCAGTGTATGGCTGCTCAGACAGGATTACATGCTGCTTCGCTTCTAGCTCCCACCTGTTTTACTGGAAGTAGAAGCATTTACTCCTGTTTGTTTCCGTTTGTTTCCCAATTGCAGTTCTTTAACTGTTGCTTACGCTAGGTGTACAGCAAGTCCGGTCATCTGGTGGCAGTGGCAGTAAATGCCTTAGCGGGTCTAAGCGGGTCTAGTTCCACTGCCAGGAAGGGCTTCATGGAATCGCTGCGAGCGCGAGCTGAGCTGCGATTGTCCGACATTGTCCGACTGTGACTACGTTCGC

Full Affymetrix probeset data:

Annotations for 1635175_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime