FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635177_at:

>probe:Drosophila_2:1635177_at:551:711; Interrogation_Position=109; Antisense; TTCCGAACAAACACCTGCTGTATCT
>probe:Drosophila_2:1635177_at:356:95; Interrogation_Position=185; Antisense; AGATTGAGTCGTACCAGAACCTGCA
>probe:Drosophila_2:1635177_at:214:587; Interrogation_Position=281; Antisense; TGGACGAGCTGAATCTTCTGGGCCC
>probe:Drosophila_2:1635177_at:574:631; Interrogation_Position=329; Antisense; TCGGGCCCGTTCTGGTCAAACAGGA
>probe:Drosophila_2:1635177_at:296:77; Interrogation_Position=359; Antisense; AGGAGTCGCGCCAGAATGTCGGAAA
>probe:Drosophila_2:1635177_at:93:561; Interrogation_Position=379; Antisense; GGAAAGCGCATCGAGTACATCTCCA
>probe:Drosophila_2:1635177_at:135:209; Interrogation_Position=457; Antisense; AAGCATCGGGAATCCGTGGCCAAGT
>probe:Drosophila_2:1635177_at:303:579; Interrogation_Position=474; Antisense; GGCCAAGTACCAACAGCAGTGTCAG
>probe:Drosophila_2:1635177_at:293:521; Interrogation_Position=499; Antisense; GTGGCGGCGGCCATGCAGTAAATAA
>probe:Drosophila_2:1635177_at:17:275; Interrogation_Position=556; Antisense; CTTATTTTCGGACAGCTTGGTGGCT
>probe:Drosophila_2:1635177_at:7:533; Interrogation_Position=574; Antisense; GGTGGCTTTCGAAACTCAACTGGCA
>probe:Drosophila_2:1635177_at:291:585; Interrogation_Position=594; Antisense; TGGCACGACCGCTTTACCTTAAAAT
>probe:Drosophila_2:1635177_at:195:671; Interrogation_Position=71; Antisense; TAGCAACCGGTGAAGCAACTGTTTC
>probe:Drosophila_2:1635177_at:7:647; Interrogation_Position=94; Antisense; TCATTAAACACCCTATTCCGAACAA

Paste this into a BLAST search page for me
TTCCGAACAAACACCTGCTGTATCTAGATTGAGTCGTACCAGAACCTGCATGGACGAGCTGAATCTTCTGGGCCCTCGGGCCCGTTCTGGTCAAACAGGAAGGAGTCGCGCCAGAATGTCGGAAAGGAAAGCGCATCGAGTACATCTCCAAAGCATCGGGAATCCGTGGCCAAGTGGCCAAGTACCAACAGCAGTGTCAGGTGGCGGCGGCCATGCAGTAAATAACTTATTTTCGGACAGCTTGGTGGCTGGTGGCTTTCGAAACTCAACTGGCATGGCACGACCGCTTTACCTTAAAATTAGCAACCGGTGAAGCAACTGTTTCTCATTAAACACCCTATTCCGAACAA

Full Affymetrix probeset data:

Annotations for 1635177_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720