FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635178_at:

>probe:Drosophila_2:1635178_at:289:425; Interrogation_Position=156; Antisense; GAGATTCGTAAGTGCAGCCATGGGA
>probe:Drosophila_2:1635178_at:595:295; Interrogation_Position=199; Antisense; CGACTTCAACACTGGATTGTCTTCC
>probe:Drosophila_2:1635178_at:413:5; Interrogation_Position=214; Antisense; ATTGTCTTCCAGCTTCTGATTTGTA
>probe:Drosophila_2:1635178_at:631:485; Interrogation_Position=236; Antisense; GTAGTATTCAGCTGATTTGCGCATC
>probe:Drosophila_2:1635178_at:439:451; Interrogation_Position=393; Antisense; GATCTCGAAGCATGTGCCGGTGCAT
>probe:Drosophila_2:1635178_at:293:535; Interrogation_Position=465; Antisense; GGTGCCCAACGTAATTCGGCTTCAA
>probe:Drosophila_2:1635178_at:648:639; Interrogation_Position=480; Antisense; TCGGCTTCAAATTCCGGAACCCTAT
>probe:Drosophila_2:1635178_at:425:551; Interrogation_Position=528; Antisense; GGAGATCCATGTGCCGGTGTATAAA
>probe:Drosophila_2:1635178_at:97:173; Interrogation_Position=573; Antisense; AAAGAAGATACCCTACACCGTCGAG
>probe:Drosophila_2:1635178_at:59:295; Interrogation_Position=594; Antisense; CGAGAAGCCATACCCCGTCGAGGTG
>probe:Drosophila_2:1635178_at:604:531; Interrogation_Position=615; Antisense; GGTGGAGAAACCTTATCCCGTCGAG
>probe:Drosophila_2:1635178_at:597:349; Interrogation_Position=648; Antisense; GCAGATCAAGATCCCGGTGCCTAAG
>probe:Drosophila_2:1635178_at:194:631; Interrogation_Position=678; Antisense; TCCTGTTCCGTTTACCATCTACAAA
>probe:Drosophila_2:1635178_at:17:39; Interrogation_Position=694; Antisense; ATCTACAAACACGTCCTGCAAAAGG

Paste this into a BLAST search page for me
GAGATTCGTAAGTGCAGCCATGGGACGACTTCAACACTGGATTGTCTTCCATTGTCTTCCAGCTTCTGATTTGTAGTAGTATTCAGCTGATTTGCGCATCGATCTCGAAGCATGTGCCGGTGCATGGTGCCCAACGTAATTCGGCTTCAATCGGCTTCAAATTCCGGAACCCTATGGAGATCCATGTGCCGGTGTATAAAAAAGAAGATACCCTACACCGTCGAGCGAGAAGCCATACCCCGTCGAGGTGGGTGGAGAAACCTTATCCCGTCGAGGCAGATCAAGATCCCGGTGCCTAAGTCCTGTTCCGTTTACCATCTACAAAATCTACAAACACGTCCTGCAAAAGG

Full Affymetrix probeset data:

Annotations for 1635178_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720