Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635180_at:

>probe:Drosophila_2:1635180_at:543:341; Interrogation_Position=1094; Antisense; GCTTTTTTCCATGCCCAGACTTTCG
>probe:Drosophila_2:1635180_at:635:263; Interrogation_Position=1109; Antisense; CAGACTTTCGCTGCAGTTTTCATTT
>probe:Drosophila_2:1635180_at:281:477; Interrogation_Position=1124; Antisense; GTTTTCATTTCAGAGCGCAACTCGA
>probe:Drosophila_2:1635180_at:222:325; Interrogation_Position=1138; Antisense; GCGCAACTCGAGAAGCAACATCAAA
>probe:Drosophila_2:1635180_at:484:283; Interrogation_Position=1183; Antisense; CTGCATGCCGCAGATACTGAAAAAA
>probe:Drosophila_2:1635180_at:242:653; Interrogation_Position=1237; Antisense; TAATTGACTTACATTCCTCCAGGGC
>probe:Drosophila_2:1635180_at:34:323; Interrogation_Position=1260; Antisense; GCCCACGGGTGGTATGATGAATATT
>probe:Drosophila_2:1635180_at:473:395; Interrogation_Position=1286; Antisense; GAAATCGGCACTTACTAGTCGCATA
>probe:Drosophila_2:1635180_at:16:347; Interrogation_Position=1306; Antisense; GCATATGACCATCTATTACTCCACC
>probe:Drosophila_2:1635180_at:215:629; Interrogation_Position=1325; Antisense; TCCACCCGAGAAATGTTATCTACAA
>probe:Drosophila_2:1635180_at:572:147; Interrogation_Position=1402; Antisense; ACTTCTTTGTTTTCATTACTGTTAT
>probe:Drosophila_2:1635180_at:319:49; Interrogation_Position=1476; Antisense; ATCCAGGGATGTTGATCACTTCATG
>probe:Drosophila_2:1635180_at:334:453; Interrogation_Position=1489; Antisense; GATCACTTCATGTATGCATCATTAA
>probe:Drosophila_2:1635180_at:127:545; Interrogation_Position=1617; Antisense; GGATACCCCATCTTAAATATAATCG

Paste this into a BLAST search page for me
GCTTTTTTCCATGCCCAGACTTTCGCAGACTTTCGCTGCAGTTTTCATTTGTTTTCATTTCAGAGCGCAACTCGAGCGCAACTCGAGAAGCAACATCAAACTGCATGCCGCAGATACTGAAAAAATAATTGACTTACATTCCTCCAGGGCGCCCACGGGTGGTATGATGAATATTGAAATCGGCACTTACTAGTCGCATAGCATATGACCATCTATTACTCCACCTCCACCCGAGAAATGTTATCTACAAACTTCTTTGTTTTCATTACTGTTATATCCAGGGATGTTGATCACTTCATGGATCACTTCATGTATGCATCATTAAGGATACCCCATCTTAAATATAATCG

Full Affymetrix probeset data:

Annotations for 1635180_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime