FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635181_at:

>probe:Drosophila_2:1635181_at:229:683; Interrogation_Position=117; Antisense; TATCGGTCTGTCGATTGTGTGCGCC
>probe:Drosophila_2:1635181_at:97:437; Interrogation_Position=165; Antisense; GAGGATTTGCTTGCCTTATGTGCCA
>probe:Drosophila_2:1635181_at:432:705; Interrogation_Position=180; Antisense; TTATGTGCCAGCGACGACCGAGCAA
>probe:Drosophila_2:1635181_at:626:239; Interrogation_Position=204; Antisense; AATACAGAACGTTCTCAGCTTCCTG
>probe:Drosophila_2:1635181_at:369:631; Interrogation_Position=224; Antisense; TCCTGCCCAAGAATTCGGCCGGAAA
>probe:Drosophila_2:1635181_at:461:329; Interrogation_Position=292; Antisense; GCGGCACAGCATTGTGGTGCTCTAA
>probe:Drosophila_2:1635181_at:636:529; Interrogation_Position=330; Antisense; GGAGCTAAACCCATGGCTGGTCTAC
>probe:Drosophila_2:1635181_at:665:367; Interrogation_Position=39; Antisense; GAATCCGCTTGCCAAGACGCCGAAA
>probe:Drosophila_2:1635181_at:461:461; Interrogation_Position=401; Antisense; GATTTTTTCGGCGAGATCTCTGGAA
>probe:Drosophila_2:1635181_at:48:403; Interrogation_Position=439; Antisense; GACTACAACTTCGTGGTCATTTTTG
>probe:Drosophila_2:1635181_at:96:193; Interrogation_Position=497; Antisense; AACTCATTGCTGAGTGTCCGCACAA
>probe:Drosophila_2:1635181_at:627:147; Interrogation_Position=549; Antisense; ACTACCCAGCCTAGAGCACGTGAAG
>probe:Drosophila_2:1635181_at:101:423; Interrogation_Position=587; Antisense; GAGTAAACACCGTCTGGTTCTACGA
>probe:Drosophila_2:1635181_at:723:183; Interrogation_Position=61; Antisense; AAAAGTGGCATGTCCACGGGCGGCA

Paste this into a BLAST search page for me
TATCGGTCTGTCGATTGTGTGCGCCGAGGATTTGCTTGCCTTATGTGCCATTATGTGCCAGCGACGACCGAGCAAAATACAGAACGTTCTCAGCTTCCTGTCCTGCCCAAGAATTCGGCCGGAAAGCGGCACAGCATTGTGGTGCTCTAAGGAGCTAAACCCATGGCTGGTCTACGAATCCGCTTGCCAAGACGCCGAAAGATTTTTTCGGCGAGATCTCTGGAAGACTACAACTTCGTGGTCATTTTTGAACTCATTGCTGAGTGTCCGCACAAACTACCCAGCCTAGAGCACGTGAAGGAGTAAACACCGTCTGGTTCTACGAAAAAGTGGCATGTCCACGGGCGGCA

Full Affymetrix probeset data:

Annotations for 1635181_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720