Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635182_at:

>probe:Drosophila_2:1635182_at:338:497; Interrogation_Position=5189; Antisense; GTCTATCACTGCTCTTCAACTGAGT
>probe:Drosophila_2:1635182_at:468:385; Interrogation_Position=5250; Antisense; GAACAAACTTAGACGTAGCCTATGT
>probe:Drosophila_2:1635182_at:438:203; Interrogation_Position=5278; Antisense; AAGCTAGCAATGTTAGACCAACTTG
>probe:Drosophila_2:1635182_at:2:415; Interrogation_Position=5293; Antisense; GACCAACTTGTTGAATGCCAAATGA
>probe:Drosophila_2:1635182_at:296:53; Interrogation_Position=5314; Antisense; ATGAAATTGTTTAGCCCCACGAGGA
>probe:Drosophila_2:1635182_at:557:527; Interrogation_Position=5347; Antisense; GGGAAATTCAACACTTATTCTCTGA
>probe:Drosophila_2:1635182_at:678:681; Interrogation_Position=5468; Antisense; TATGCTAGAGTTGTGTAGCGCCCTA
>probe:Drosophila_2:1635182_at:525:589; Interrogation_Position=5479; Antisense; TGTGTAGCGCCCTAAGATGTTTTTT
>probe:Drosophila_2:1635182_at:285:477; Interrogation_Position=5505; Antisense; GTTTATAGACCGCTAACCGTAATCT
>probe:Drosophila_2:1635182_at:18:479; Interrogation_Position=5531; Antisense; GTTTAATTCCTAACACTAAGCGAGA
>probe:Drosophila_2:1635182_at:311:117; Interrogation_Position=5637; Antisense; AGCTTCAGTTTGTATGTGCGTGTGT
>probe:Drosophila_2:1635182_at:19:23; Interrogation_Position=5678; Antisense; ATATAGTCCATCTGAATATTCGTGG
>probe:Drosophila_2:1635182_at:493:21; Interrogation_Position=5693; Antisense; ATATTCGTGGATGGAGCCTATTTTA
>probe:Drosophila_2:1635182_at:592:179; Interrogation_Position=5749; Antisense; AAACAAACTCTGTGTGCCTTGGCCA

Paste this into a BLAST search page for me
GTCTATCACTGCTCTTCAACTGAGTGAACAAACTTAGACGTAGCCTATGTAAGCTAGCAATGTTAGACCAACTTGGACCAACTTGTTGAATGCCAAATGAATGAAATTGTTTAGCCCCACGAGGAGGGAAATTCAACACTTATTCTCTGATATGCTAGAGTTGTGTAGCGCCCTATGTGTAGCGCCCTAAGATGTTTTTTGTTTATAGACCGCTAACCGTAATCTGTTTAATTCCTAACACTAAGCGAGAAGCTTCAGTTTGTATGTGCGTGTGTATATAGTCCATCTGAATATTCGTGGATATTCGTGGATGGAGCCTATTTTAAAACAAACTCTGTGTGCCTTGGCCA

Full Affymetrix probeset data:

Annotations for 1635182_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime