FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635183_at:

>probe:Drosophila_2:1635183_at:55:525; Interrogation_Position=1049; Antisense; GGGCGTCCATACAATGTTCTCGAGA
>probe:Drosophila_2:1635183_at:211:511; Interrogation_Position=1078; Antisense; GTGACTTTGGCAACATGTACCGCAT
>probe:Drosophila_2:1635183_at:706:59; Interrogation_Position=1092; Antisense; ATGTACCGCATGTTTGTCAGCCATT
>probe:Drosophila_2:1635183_at:593:599; Interrogation_Position=1106; Antisense; TGTCAGCCATTTCATTAACGCAGTG
>probe:Drosophila_2:1635183_at:617:537; Interrogation_Position=1151; Antisense; GGTCACTGAAGCTGGCGTGGATCAA
>probe:Drosophila_2:1635183_at:32:519; Interrogation_Position=1167; Antisense; GTGGATCAACCCCTGGAAACTGGAT
>probe:Drosophila_2:1635183_at:497:709; Interrogation_Position=1195; Antisense; TTAAAGGACTCTTTTCGCGCTCCAA
>probe:Drosophila_2:1635183_at:180:373; Interrogation_Position=1220; Antisense; GAAGTTCGAGGCAGATCATCCGTTC
>probe:Drosophila_2:1635183_at:687:45; Interrogation_Position=1237; Antisense; ATCCGTTCGTGTTCGCCATCAAGTA
>probe:Drosophila_2:1635183_at:684:235; Interrogation_Position=1271; Antisense; AATCGCCTTTATCGGACACATTGCT
>probe:Drosophila_2:1635183_at:465:519; Interrogation_Position=788; Antisense; GTGGACGCTGCAGAACTTCAACTAC
>probe:Drosophila_2:1635183_at:585:77; Interrogation_Position=901; Antisense; AGGATGGTCTGAGATCCCTGCAGCA
>probe:Drosophila_2:1635183_at:671:87; Interrogation_Position=925; Antisense; AGTCGCTGTCCGGTAAGAATCTTCT
>probe:Drosophila_2:1635183_at:14:621; Interrogation_Position=991; Antisense; TGCTGCCCAAGTTTAGTGTCACCTT

Paste this into a BLAST search page for me
GGGCGTCCATACAATGTTCTCGAGAGTGACTTTGGCAACATGTACCGCATATGTACCGCATGTTTGTCAGCCATTTGTCAGCCATTTCATTAACGCAGTGGGTCACTGAAGCTGGCGTGGATCAAGTGGATCAACCCCTGGAAACTGGATTTAAAGGACTCTTTTCGCGCTCCAAGAAGTTCGAGGCAGATCATCCGTTCATCCGTTCGTGTTCGCCATCAAGTAAATCGCCTTTATCGGACACATTGCTGTGGACGCTGCAGAACTTCAACTACAGGATGGTCTGAGATCCCTGCAGCAAGTCGCTGTCCGGTAAGAATCTTCTTGCTGCCCAAGTTTAGTGTCACCTT

Full Affymetrix probeset data:

Annotations for 1635183_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720