FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635185_at:

>probe:Drosophila_2:1635185_at:568:275; Interrogation_Position=1004; Antisense; CTTTAAGTCCGTCCAGGCTGTGCTG
>probe:Drosophila_2:1635185_at:550:573; Interrogation_Position=1019; Antisense; GGCTGTGCTGCAAGAACTTCGAGAT
>probe:Drosophila_2:1635185_at:553:141; Interrogation_Position=594; Antisense; ACTAGTTTAGGCGACATACCACAAA
>probe:Drosophila_2:1635185_at:544:703; Interrogation_Position=676; Antisense; TTATCACACAGTTATGCTACCGTCC
>probe:Drosophila_2:1635185_at:353:305; Interrogation_Position=695; Antisense; CCGTCCCGAGGTCATAGTGCAATTT
>probe:Drosophila_2:1635185_at:282:75; Interrogation_Position=724; Antisense; AGGACTGTCGAGCAGCTGGAATCTC
>probe:Drosophila_2:1635185_at:349:565; Interrogation_Position=741; Antisense; GGAATCTCGGTACCCATTGTTGTGG
>probe:Drosophila_2:1635185_at:135:407; Interrogation_Position=766; Antisense; GACTGATGTCGCATGAATCCTTTCG
>probe:Drosophila_2:1635185_at:548:233; Interrogation_Position=781; Antisense; AATCCTTTCGCTCCTACTCAATGAT
>probe:Drosophila_2:1635185_at:508:449; Interrogation_Position=803; Antisense; GATCGAGCAAATAACCGGCGTCCAT
>probe:Drosophila_2:1635185_at:606:101; Interrogation_Position=845; Antisense; AGAGCAACTCGATCAGCTGCATAGT
>probe:Drosophila_2:1635185_at:298:47; Interrogation_Position=909; Antisense; AGAAGGTTCTTTGTTAGCCTCACCG
>probe:Drosophila_2:1635185_at:239:649; Interrogation_Position=928; Antisense; TCACCGTCCGAACGATTCGTAATGT
>probe:Drosophila_2:1635185_at:314:713; Interrogation_Position=987; Antisense; TTCTTCACACTCAACCGCTTTAAGT

Paste this into a BLAST search page for me
CTTTAAGTCCGTCCAGGCTGTGCTGGGCTGTGCTGCAAGAACTTCGAGATACTAGTTTAGGCGACATACCACAAATTATCACACAGTTATGCTACCGTCCCCGTCCCGAGGTCATAGTGCAATTTAGGACTGTCGAGCAGCTGGAATCTCGGAATCTCGGTACCCATTGTTGTGGGACTGATGTCGCATGAATCCTTTCGAATCCTTTCGCTCCTACTCAATGATGATCGAGCAAATAACCGGCGTCCATAGAGCAACTCGATCAGCTGCATAGTAGAAGGTTCTTTGTTAGCCTCACCGTCACCGTCCGAACGATTCGTAATGTTTCTTCACACTCAACCGCTTTAAGT

Full Affymetrix probeset data:

Annotations for 1635185_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720