FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635186_at:

>probe:Drosophila_2:1635186_at:548:707; Interrogation_Position=1011; Antisense; TTACGCCCATATTCAACAAACACAC
>probe:Drosophila_2:1635186_at:261:243; Interrogation_Position=1104; Antisense; AATATTCGATCGTTGAGAACTCTGT
>probe:Drosophila_2:1635186_at:129:423; Interrogation_Position=1118; Antisense; GAGAACTCTGTTTAATCACCAAGTG
>probe:Drosophila_2:1635186_at:525:451; Interrogation_Position=1251; Antisense; GATACTGAATCCCACTTAACTTGCA
>probe:Drosophila_2:1635186_at:108:345; Interrogation_Position=1273; Antisense; GCATATAAACAATATTCAGCGCTTT
>probe:Drosophila_2:1635186_at:190:197; Interrogation_Position=1323; Antisense; AACGATTATCGCGAGCAATCTGAGT
>probe:Drosophila_2:1635186_at:162:327; Interrogation_Position=1333; Antisense; GCGAGCAATCTGAGTTTTGCATTGA
>probe:Drosophila_2:1635186_at:147:227; Interrogation_Position=1396; Antisense; AAGGCGGATTGCTGAAGCCGTCTGC
>probe:Drosophila_2:1635186_at:335:331; Interrogation_Position=1419; Antisense; GCGGCTTTAGTATTCCCTTTTGATA
>probe:Drosophila_2:1635186_at:503:419; Interrogation_Position=906; Antisense; GAGCTACCGGCGCAAGATCTTGATA
>probe:Drosophila_2:1635186_at:352:361; Interrogation_Position=917; Antisense; GCAAGATCTTGATACTCCTGGTGAT
>probe:Drosophila_2:1635186_at:428:29; Interrogation_Position=928; Antisense; ATACTCCTGGTGATCGCTGTGATAA
>probe:Drosophila_2:1635186_at:160:679; Interrogation_Position=953; Antisense; TAGGTTTAATCGTAACTGGCGTTAT
>probe:Drosophila_2:1635186_at:102:575; Interrogation_Position=970; Antisense; GGCGTTATCGTTGCCAAACTGAACA

Paste this into a BLAST search page for me
TTACGCCCATATTCAACAAACACACAATATTCGATCGTTGAGAACTCTGTGAGAACTCTGTTTAATCACCAAGTGGATACTGAATCCCACTTAACTTGCAGCATATAAACAATATTCAGCGCTTTAACGATTATCGCGAGCAATCTGAGTGCGAGCAATCTGAGTTTTGCATTGAAAGGCGGATTGCTGAAGCCGTCTGCGCGGCTTTAGTATTCCCTTTTGATAGAGCTACCGGCGCAAGATCTTGATAGCAAGATCTTGATACTCCTGGTGATATACTCCTGGTGATCGCTGTGATAATAGGTTTAATCGTAACTGGCGTTATGGCGTTATCGTTGCCAAACTGAACA

Full Affymetrix probeset data:

Annotations for 1635186_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720