FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635188_at:

>probe:Drosophila_2:1635188_at:522:597; Interrogation_Position=1067; Antisense; TGCCACCTTTTATCCAAACTACGGG
>probe:Drosophila_2:1635188_at:663:115; Interrogation_Position=1099; Antisense; AGCATAGCTGCTACTACCTAGGTTG
>probe:Drosophila_2:1635188_at:547:679; Interrogation_Position=1117; Antisense; TAGGTTGCTCCCATATTCGATCATA
>probe:Drosophila_2:1635188_at:265:647; Interrogation_Position=1137; Antisense; TCATATCAGATGTTCGCCGAGTCCA
>probe:Drosophila_2:1635188_at:700:431; Interrogation_Position=1155; Antisense; GAGTCCATCAATTCGCCTTTGGGAT
>probe:Drosophila_2:1635188_at:51:327; Interrogation_Position=1222; Antisense; GCGATTATAGCCAGCGACAGTCCAT
>probe:Drosophila_2:1635188_at:258:579; Interrogation_Position=1253; Antisense; GGCCGGTGAGCCATCGATTCATAAA
>probe:Drosophila_2:1635188_at:251:615; Interrogation_Position=1294; Antisense; TGAAGACCTCCAGCAGTGATCCATT
>probe:Drosophila_2:1635188_at:178:449; Interrogation_Position=1311; Antisense; GATCCATTCGCCCTTGGAAAGCAAT
>probe:Drosophila_2:1635188_at:518:101; Interrogation_Position=781; Antisense; AGACCTTTGGAGCTGAGTTGGCCCA
>probe:Drosophila_2:1635188_at:219:381; Interrogation_Position=815; Antisense; GAACCTCAATCGTCAGTTTGGAGCT
>probe:Drosophila_2:1635188_at:166:483; Interrogation_Position=854; Antisense; GTATCTTATTGGTCACTCCTTGGGA
>probe:Drosophila_2:1635188_at:480:449; Interrogation_Position=884; Antisense; GATCGCTGGTTCTGCCGGGAAACGT
>probe:Drosophila_2:1635188_at:455:243; Interrogation_Position=932; Antisense; AATATTTGCTTTGGATCCCGCAGGT

Paste this into a BLAST search page for me
TGCCACCTTTTATCCAAACTACGGGAGCATAGCTGCTACTACCTAGGTTGTAGGTTGCTCCCATATTCGATCATATCATATCAGATGTTCGCCGAGTCCAGAGTCCATCAATTCGCCTTTGGGATGCGATTATAGCCAGCGACAGTCCATGGCCGGTGAGCCATCGATTCATAAATGAAGACCTCCAGCAGTGATCCATTGATCCATTCGCCCTTGGAAAGCAATAGACCTTTGGAGCTGAGTTGGCCCAGAACCTCAATCGTCAGTTTGGAGCTGTATCTTATTGGTCACTCCTTGGGAGATCGCTGGTTCTGCCGGGAAACGTAATATTTGCTTTGGATCCCGCAGGT

Full Affymetrix probeset data:

Annotations for 1635188_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720