FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635189_at:

>probe:Drosophila_2:1635189_at:389:447; Interrogation_Position=104; Antisense; GATGCTGGTGGTCCTGGGAGCCAAC
>probe:Drosophila_2:1635189_at:502:303; Interrogation_Position=139; Antisense; CCGACTGCCTGTCCGGAAGATACAA
>probe:Drosophila_2:1635189_at:85:215; Interrogation_Position=155; Antisense; AAGATACAAGGGTCCCTGTGCCGTC
>probe:Drosophila_2:1635189_at:640:395; Interrogation_Position=25; Antisense; GAAATCATTTACCAAGCTCCGTGAG
>probe:Drosophila_2:1635189_at:563:371; Interrogation_Position=264; Antisense; GAAGGATGCTAAATCCATGAGCAAT
>probe:Drosophila_2:1635189_at:164:421; Interrogation_Position=282; Antisense; GAGCAATTAGCATGAACGTTCTGAA
>probe:Drosophila_2:1635189_at:728:675; Interrogation_Position=289; Antisense; TAGCATGAACGTTCTGAAAAGCGCG
>probe:Drosophila_2:1635189_at:419:613; Interrogation_Position=303; Antisense; TGAAAAGCGCGTTTAGCTCTCCACT
>probe:Drosophila_2:1635189_at:609:675; Interrogation_Position=316; Antisense; TAGCTCTCCACTACTTACACATATT
>probe:Drosophila_2:1635189_at:527:667; Interrogation_Position=327; Antisense; TACTTACACATATTCTATGCTGCAA
>probe:Drosophila_2:1635189_at:474:207; Interrogation_Position=38; Antisense; AAGCTCCGTGAGAACCTTTTCCAAT
>probe:Drosophila_2:1635189_at:45:381; Interrogation_Position=49; Antisense; GAACCTTTTCCAATATGATGCAGAT
>probe:Drosophila_2:1635189_at:582:95; Interrogation_Position=70; Antisense; AGATCAAGTACTTGTTCGCCCTCTT
>probe:Drosophila_2:1635189_at:655:645; Interrogation_Position=91; Antisense; TCTTCGCTGTCCTGATGCTGGTGGT

Paste this into a BLAST search page for me
GATGCTGGTGGTCCTGGGAGCCAACCCGACTGCCTGTCCGGAAGATACAAAAGATACAAGGGTCCCTGTGCCGTCGAAATCATTTACCAAGCTCCGTGAGGAAGGATGCTAAATCCATGAGCAATGAGCAATTAGCATGAACGTTCTGAATAGCATGAACGTTCTGAAAAGCGCGTGAAAAGCGCGTTTAGCTCTCCACTTAGCTCTCCACTACTTACACATATTTACTTACACATATTCTATGCTGCAAAAGCTCCGTGAGAACCTTTTCCAATGAACCTTTTCCAATATGATGCAGATAGATCAAGTACTTGTTCGCCCTCTTTCTTCGCTGTCCTGATGCTGGTGGT

Full Affymetrix probeset data:

Annotations for 1635189_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720