FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635190_at:

>probe:Drosophila_2:1635190_at:576:597; Interrogation_Position=255; Antisense; TGTCCGCGCCATCCGCACAAATTTG
>probe:Drosophila_2:1635190_at:308:721; Interrogation_Position=355; Antisense; TTCCTGCTCAGCTGCATACTTTTTT
>probe:Drosophila_2:1635190_at:458:283; Interrogation_Position=358; Antisense; CTGCTCAGCTGCATACTTTTTTGGG
>probe:Drosophila_2:1635190_at:399:43; Interrogation_Position=664; Antisense; ATCGACTTAGTTCATTATTTGGCAA
>probe:Drosophila_2:1635190_at:702:687; Interrogation_Position=679; Antisense; TATTTGGCAAAAGACCACTCCGCTC
>probe:Drosophila_2:1635190_at:490:583; Interrogation_Position=683; Antisense; TGGCAAAAGACCACTCCGCTCGAAA
>probe:Drosophila_2:1635190_at:380:257; Interrogation_Position=710; Antisense; CAAAGGATGAAAGGCCGCAGGAGCC
>probe:Drosophila_2:1635190_at:256:269; Interrogation_Position=736; Antisense; CAGGACGCGCAGGACATGCTGTCGT
>probe:Drosophila_2:1635190_at:351:323; Interrogation_Position=742; Antisense; GCGCAGGACATGCTGTCGTTGTCAA
>probe:Drosophila_2:1635190_at:500:557; Interrogation_Position=747; Antisense; GGACATGCTGTCGTTGTCAACGCTG
>probe:Drosophila_2:1635190_at:65:639; Interrogation_Position=757; Antisense; TCGTTGTCAACGCTGCTGCTGGCAG
>probe:Drosophila_2:1635190_at:147:285; Interrogation_Position=769; Antisense; CTGCTGCTGGCAGGCCTCAAAAATG
>probe:Drosophila_2:1635190_at:548:303; Interrogation_Position=782; Antisense; GCCTCAAAAATGCAGACCTGAAAAA
>probe:Drosophila_2:1635190_at:10:619; Interrogation_Position=792; Antisense; TGCAGACCTGAAAAATGCCAGCTAA

Paste this into a BLAST search page for me
TGTCCGCGCCATCCGCACAAATTTGTTCCTGCTCAGCTGCATACTTTTTTCTGCTCAGCTGCATACTTTTTTGGGATCGACTTAGTTCATTATTTGGCAATATTTGGCAAAAGACCACTCCGCTCTGGCAAAAGACCACTCCGCTCGAAACAAAGGATGAAAGGCCGCAGGAGCCCAGGACGCGCAGGACATGCTGTCGTGCGCAGGACATGCTGTCGTTGTCAAGGACATGCTGTCGTTGTCAACGCTGTCGTTGTCAACGCTGCTGCTGGCAGCTGCTGCTGGCAGGCCTCAAAAATGGCCTCAAAAATGCAGACCTGAAAAATGCAGACCTGAAAAATGCCAGCTAA

Full Affymetrix probeset data:

Annotations for 1635190_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720