FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635191_at:

>probe:Drosophila_2:1635191_at:51:673; Interrogation_Position=439; Antisense; TACGCGAGAATTCCTGTGCTCTGAC
>probe:Drosophila_2:1635191_at:680:637; Interrogation_Position=465; Antisense; TCGTACTCTGTGGTCATGCTGGTGC
>probe:Drosophila_2:1635191_at:464:465; Interrogation_Position=491; Antisense; GTTGGTTAGTCAGCTAGCTCTCATT
>probe:Drosophila_2:1635191_at:77:119; Interrogation_Position=506; Antisense; AGCTCTCATTATCTACGTGTGGGTG
>probe:Drosophila_2:1635191_at:525:585; Interrogation_Position=610; Antisense; TGGACACACTGCAGCGATCGTTCAA
>probe:Drosophila_2:1635191_at:623:219; Interrogation_Position=633; Antisense; AAGTGCTGCGGCTTGAACGGCTTCG
>probe:Drosophila_2:1635191_at:727:195; Interrogation_Position=648; Antisense; AACGGCTTCGCTGATTACGGCATTA
>probe:Drosophila_2:1635191_at:194:55; Interrogation_Position=732; Antisense; ATGACGCGATCCAGTTGCCTGAAGG
>probe:Drosophila_2:1635191_at:472:225; Interrogation_Position=753; Antisense; AAGGCCGTTGATTCCTTCTGGGACA
>probe:Drosophila_2:1635191_at:496:641; Interrogation_Position=769; Antisense; TCTGGGACACCAACGTGAGCATCAT
>probe:Drosophila_2:1635191_at:120:347; Interrogation_Position=787; Antisense; GCATCATCAAGTACGCTGGCCTGGG
>probe:Drosophila_2:1635191_at:584:143; Interrogation_Position=816; Antisense; ACTGCTGTTGAGCTTGTGGCCTTCA
>probe:Drosophila_2:1635191_at:320:91; Interrogation_Position=926; Antisense; AGTATTAGGATTATCTCCCGACCCT
>probe:Drosophila_2:1635191_at:726:219; Interrogation_Position=988; Antisense; AAGTGCTTCGCATGCTTACTGTATA

Paste this into a BLAST search page for me
TACGCGAGAATTCCTGTGCTCTGACTCGTACTCTGTGGTCATGCTGGTGCGTTGGTTAGTCAGCTAGCTCTCATTAGCTCTCATTATCTACGTGTGGGTGTGGACACACTGCAGCGATCGTTCAAAAGTGCTGCGGCTTGAACGGCTTCGAACGGCTTCGCTGATTACGGCATTAATGACGCGATCCAGTTGCCTGAAGGAAGGCCGTTGATTCCTTCTGGGACATCTGGGACACCAACGTGAGCATCATGCATCATCAAGTACGCTGGCCTGGGACTGCTGTTGAGCTTGTGGCCTTCAAGTATTAGGATTATCTCCCGACCCTAAGTGCTTCGCATGCTTACTGTATA

Full Affymetrix probeset data:

Annotations for 1635191_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720