Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635192_at:

>probe:Drosophila_2:1635192_at:423:87; Interrogation_Position=2837; Antisense; AGTGCCTATGGCTAGTTTCTATCTA
>probe:Drosophila_2:1635192_at:56:93; Interrogation_Position=2850; Antisense; AGTTTCTATCTATTTATTGCCTTAA
>probe:Drosophila_2:1635192_at:205:179; Interrogation_Position=3018; Antisense; AAAAATCTAATCCTGGCTTGTGTTT
>probe:Drosophila_2:1635192_at:145:631; Interrogation_Position=3028; Antisense; TCCTGGCTTGTGTTTTTACTTGTTA
>probe:Drosophila_2:1635192_at:606:601; Interrogation_Position=3054; Antisense; TGCTTACTAATGCTTTACACCGCTT
>probe:Drosophila_2:1635192_at:108:343; Interrogation_Position=3065; Antisense; GCTTTACACCGCTTGTTGACTAATT
>probe:Drosophila_2:1635192_at:494:27; Interrogation_Position=3143; Antisense; ATACCATACTAACTCGAACTAACTT
>probe:Drosophila_2:1635192_at:549:383; Interrogation_Position=3170; Antisense; GAACTGATTAATGCTTCATCTTTGA
>probe:Drosophila_2:1635192_at:195:97; Interrogation_Position=3195; Antisense; AGATACAGATCTTTCCAAGTGAGAT
>probe:Drosophila_2:1635192_at:166:513; Interrogation_Position=3213; Antisense; GTGAGATCCTACTAGCAGTTGTTAA
>probe:Drosophila_2:1635192_at:345:245; Interrogation_Position=3304; Antisense; AATTTTGCATTATTTAGAAGCCGTA
>probe:Drosophila_2:1635192_at:111:379; Interrogation_Position=3320; Antisense; GAAGCCGTAAATTTGGATTCGTATA
>probe:Drosophila_2:1635192_at:639:163; Interrogation_Position=3361; Antisense; AAATAGCTTTTCGTTTGCTATGCAA
>probe:Drosophila_2:1635192_at:529:475; Interrogation_Position=3373; Antisense; GTTTGCTATGCAATGATCCATTTGT

Paste this into a BLAST search page for me
AGTGCCTATGGCTAGTTTCTATCTAAGTTTCTATCTATTTATTGCCTTAAAAAAATCTAATCCTGGCTTGTGTTTTCCTGGCTTGTGTTTTTACTTGTTATGCTTACTAATGCTTTACACCGCTTGCTTTACACCGCTTGTTGACTAATTATACCATACTAACTCGAACTAACTTGAACTGATTAATGCTTCATCTTTGAAGATACAGATCTTTCCAAGTGAGATGTGAGATCCTACTAGCAGTTGTTAAAATTTTGCATTATTTAGAAGCCGTAGAAGCCGTAAATTTGGATTCGTATAAAATAGCTTTTCGTTTGCTATGCAAGTTTGCTATGCAATGATCCATTTGT

Full Affymetrix probeset data:

Annotations for 1635192_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime