FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635194_at:

>probe:Drosophila_2:1635194_at:499:525; Interrogation_Position=107; Antisense; GGGATGGCTCCCGAAATCTCAAGGG
>probe:Drosophila_2:1635194_at:423:495; Interrogation_Position=170; Antisense; GTCTTTTGGTGGACGAGCCTCAACT
>probe:Drosophila_2:1635194_at:223:715; Interrogation_Position=194; Antisense; TTCTGCTATTCAAGTTCGCCGAGGC
>probe:Drosophila_2:1635194_at:318:631; Interrogation_Position=209; Antisense; TCGCCGAGGCCTATATGAACCAGTT
>probe:Drosophila_2:1635194_at:228:229; Interrogation_Position=241; Antisense; AATGGTAGTGCCTGTCTGGATCGTC
>probe:Drosophila_2:1635194_at:705:443; Interrogation_Position=289; Antisense; GATGAGCATAGTGGACTCTACGCCC
>probe:Drosophila_2:1635194_at:467:193; Interrogation_Position=314; Antisense; AACTGCTCCACAGGTTGTTAAGACC
>probe:Drosophila_2:1635194_at:209:213; Interrogation_Position=333; Antisense; AAGACCTCATCAAACGCTGGACGTG
>probe:Drosophila_2:1635194_at:169:447; Interrogation_Position=367; Antisense; GATGCCTACAGGATGGGTCGCCATG
>probe:Drosophila_2:1635194_at:380:503; Interrogation_Position=383; Antisense; GTCGCCATGGCGTTGACTGCCGAAA
>probe:Drosophila_2:1635194_at:59:403; Interrogation_Position=397; Antisense; GACTGCCGAAATGCCTTTCCAGAGG
>probe:Drosophila_2:1635194_at:600:99; Interrogation_Position=417; Antisense; AGAGGCCCATCATTGCATTTTGGAT
>probe:Drosophila_2:1635194_at:195:271; Interrogation_Position=432; Antisense; CATTTTGGATGACTACCTACACCTC
>probe:Drosophila_2:1635194_at:475:317; Interrogation_Position=75; Antisense; GCCGCAAACTCCAATCTACTGGTGG

Paste this into a BLAST search page for me
GGGATGGCTCCCGAAATCTCAAGGGGTCTTTTGGTGGACGAGCCTCAACTTTCTGCTATTCAAGTTCGCCGAGGCTCGCCGAGGCCTATATGAACCAGTTAATGGTAGTGCCTGTCTGGATCGTCGATGAGCATAGTGGACTCTACGCCCAACTGCTCCACAGGTTGTTAAGACCAAGACCTCATCAAACGCTGGACGTGGATGCCTACAGGATGGGTCGCCATGGTCGCCATGGCGTTGACTGCCGAAAGACTGCCGAAATGCCTTTCCAGAGGAGAGGCCCATCATTGCATTTTGGATCATTTTGGATGACTACCTACACCTCGCCGCAAACTCCAATCTACTGGTGG

Full Affymetrix probeset data:

Annotations for 1635194_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720