Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635196_at:

>probe:Drosophila_2:1635196_at:444:283; Interrogation_Position=1008; Antisense; CTCCAACTGGTGGTGATGCTTTGCA
>probe:Drosophila_2:1635196_at:495:723; Interrogation_Position=1028; Antisense; TTGCAAACTGCAGTACCTGGTACTC
>probe:Drosophila_2:1635196_at:660:489; Interrogation_Position=1047; Antisense; GTACTCTATGATCAGCTGGACGGCA
>probe:Drosophila_2:1635196_at:144:529; Interrogation_Position=1084; Antisense; GGGAGTATCCCATTAATCACACCGT
>probe:Drosophila_2:1635196_at:259:191; Interrogation_Position=1118; Antisense; AACTATCATCAACATCCTTATCCTG
>probe:Drosophila_2:1635196_at:664:589; Interrogation_Position=1150; Antisense; TGGTTCTCGTATCCATGATGGTTCA
>probe:Drosophila_2:1635196_at:337:651; Interrogation_Position=1172; Antisense; TCAAAGTGCATATCGTACTCCCGTT
>probe:Drosophila_2:1635196_at:152:283; Interrogation_Position=1237; Antisense; CTCGCATTTGAGTGTGCCTATGAAT
>probe:Drosophila_2:1635196_at:519:227; Interrogation_Position=768; Antisense; AAGGCGAAACTCTGCATCTCCAGAT
>probe:Drosophila_2:1635196_at:526:537; Interrogation_Position=797; Antisense; GGTATGGCAAATGCCCTTCTGGCAG
>probe:Drosophila_2:1635196_at:519:569; Interrogation_Position=817; Antisense; GGCAGGGCTCCATTATGCTGGTGAT
>probe:Drosophila_2:1635196_at:550:685; Interrogation_Position=850; Antisense; TATACTACCGGGACATTCAGCTCTA
>probe:Drosophila_2:1635196_at:647:117; Interrogation_Position=868; Antisense; AGCTCTACCGGCAGGTCATGTTCTT
>probe:Drosophila_2:1635196_at:356:209; Interrogation_Position=993; Antisense; AAGAAGATGTTCTGCCTCCAACTGG

Paste this into a BLAST search page for me
CTCCAACTGGTGGTGATGCTTTGCATTGCAAACTGCAGTACCTGGTACTCGTACTCTATGATCAGCTGGACGGCAGGGAGTATCCCATTAATCACACCGTAACTATCATCAACATCCTTATCCTGTGGTTCTCGTATCCATGATGGTTCATCAAAGTGCATATCGTACTCCCGTTCTCGCATTTGAGTGTGCCTATGAATAAGGCGAAACTCTGCATCTCCAGATGGTATGGCAAATGCCCTTCTGGCAGGGCAGGGCTCCATTATGCTGGTGATTATACTACCGGGACATTCAGCTCTAAGCTCTACCGGCAGGTCATGTTCTTAAGAAGATGTTCTGCCTCCAACTGG

Full Affymetrix probeset data:

Annotations for 1635196_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime