Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635198_at:

>probe:Drosophila_2:1635198_at:488:471; Interrogation_Position=1668; Antisense; GTTCGACTCGAAGGCGGGCGACAAT
>probe:Drosophila_2:1635198_at:711:521; Interrogation_Position=1683; Antisense; GGGCGACAATCGATTCTTGCGTGAG
>probe:Drosophila_2:1635198_at:453:139; Interrogation_Position=1726; Antisense; ACGTGGTTCTACTACTTTGGCATAA
>probe:Drosophila_2:1635198_at:513:697; Interrogation_Position=1758; Antisense; TTTAATACTGCGCTTCAGCTGGACC
>probe:Drosophila_2:1635198_at:596:583; Interrogation_Position=1777; Antisense; TGGACCCTGTCCATGAGTCTAATTG
>probe:Drosophila_2:1635198_at:425:431; Interrogation_Position=1791; Antisense; GAGTCTAATTGAGGCTGGCTACATT
>probe:Drosophila_2:1635198_at:324:513; Interrogation_Position=1825; Antisense; GTGATGATGACCATTCTCAGTCCCC
>probe:Drosophila_2:1635198_at:113:477; Interrogation_Position=1855; Antisense; GTTTTCCGTCGCTTCATTTGGAATT
>probe:Drosophila_2:1635198_at:145:139; Interrogation_Position=1910; Antisense; ACGTGGGCAAATTCAGGGCTGTCAG
>probe:Drosophila_2:1635198_at:243:495; Interrogation_Position=1930; Antisense; GTCAGGGATATATCGGTCGCTCCAA
>probe:Drosophila_2:1635198_at:422:635; Interrogation_Position=1946; Antisense; TCGCTCCAATGGATTGCTCGGATCA
>probe:Drosophila_2:1635198_at:233:545; Interrogation_Position=1965; Antisense; GGATCAGACCACGATTTTGCGCATG
>probe:Drosophila_2:1635198_at:375:451; Interrogation_Position=2107; Antisense; GATCTTTGCTCGTAGTTGGGTTACC
>probe:Drosophila_2:1635198_at:138:191; Interrogation_Position=2137; Antisense; AACATCTATCTCTCTGTGTGCACAA

Paste this into a BLAST search page for me
GTTCGACTCGAAGGCGGGCGACAATGGGCGACAATCGATTCTTGCGTGAGACGTGGTTCTACTACTTTGGCATAATTTAATACTGCGCTTCAGCTGGACCTGGACCCTGTCCATGAGTCTAATTGGAGTCTAATTGAGGCTGGCTACATTGTGATGATGACCATTCTCAGTCCCCGTTTTCCGTCGCTTCATTTGGAATTACGTGGGCAAATTCAGGGCTGTCAGGTCAGGGATATATCGGTCGCTCCAATCGCTCCAATGGATTGCTCGGATCAGGATCAGACCACGATTTTGCGCATGGATCTTTGCTCGTAGTTGGGTTACCAACATCTATCTCTCTGTGTGCACAA

Full Affymetrix probeset data:

Annotations for 1635198_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime