Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635199_at:

>probe:Drosophila_2:1635199_at:582:247; Interrogation_Position=3391; Antisense; AATTGCATTTCGATCGAGCAGGAAA
>probe:Drosophila_2:1635199_at:173:421; Interrogation_Position=3406; Antisense; GAGCAGGAAACCCAATCTCCATGCG
>probe:Drosophila_2:1635199_at:328:269; Interrogation_Position=3425; Antisense; CATGCGCTTCGCTAGCTATTTTAGT
>probe:Drosophila_2:1635199_at:270:537; Interrogation_Position=3478; Antisense; GGTCTAGGATATGGACACGCCACAT
>probe:Drosophila_2:1635199_at:77:351; Interrogation_Position=3509; Antisense; GCAGCACACAGGACACACCGTAAAC
>probe:Drosophila_2:1635199_at:352:491; Interrogation_Position=3528; Antisense; GTAAACACACGGCAACCAGTCACGC
>probe:Drosophila_2:1635199_at:377:129; Interrogation_Position=3542; Antisense; ACCAGTCACGCATGTTTCCTTAATA
>probe:Drosophila_2:1635199_at:564:211; Interrogation_Position=3601; Antisense; AATAAACCCCACACAGACGCAAAAT
>probe:Drosophila_2:1635199_at:289:191; Interrogation_Position=3636; Antisense; AACTCAAGCACAGAACCACGGATAT
>probe:Drosophila_2:1635199_at:104:341; Interrogation_Position=3686; Antisense; TGAATGGAAAACTCCTTTGGGTCAA
>probe:Drosophila_2:1635199_at:693:529; Interrogation_Position=3704; Antisense; GGGTCAAAGTCCAGCAGTGTCCAAG
>probe:Drosophila_2:1635199_at:547:591; Interrogation_Position=3747; Antisense; TGGGTTTGCCTATGGTGTCCTCGAA
>probe:Drosophila_2:1635199_at:141:191; Interrogation_Position=3816; Antisense; AACATCATCGGATGGTCACCGACCA
>probe:Drosophila_2:1635199_at:243:131; Interrogation_Position=3833; Antisense; ACCGACCATTTCCTAACTTCTAGAT

Paste this into a BLAST search page for me
AATTGCATTTCGATCGAGCAGGAAAGAGCAGGAAACCCAATCTCCATGCGCATGCGCTTCGCTAGCTATTTTAGTGGTCTAGGATATGGACACGCCACATGCAGCACACAGGACACACCGTAAACGTAAACACACGGCAACCAGTCACGCACCAGTCACGCATGTTTCCTTAATAAATAAACCCCACACAGACGCAAAATAACTCAAGCACAGAACCACGGATATTGAATGGAAAACTCCTTTGGGTCAAGGGTCAAAGTCCAGCAGTGTCCAAGTGGGTTTGCCTATGGTGTCCTCGAAAACATCATCGGATGGTCACCGACCAACCGACCATTTCCTAACTTCTAGAT

Full Affymetrix probeset data:

Annotations for 1635199_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime